Wednesday, August 26, 2020
Lockheed Martin Corporation Essay Essay Example
Lockheed Martin Corporation Essay Example Lockheed Martin Corporation Essay Lockheed Martin Corporation Essay Lockheed Martin is an American aviation worldwide that other than has practical experience in barrier. security and propelled building ventures. The organization was established in 1995 after the amalgamation between Lockheed Corporation and Martin Marietta ( Yenne. 2000 ) . The organization is situated in Bethesda in Maryland with planetary focuses that have some expertise in various features of the corporationââ¬â¢s numerous tasks. By and by. the enterprise utilizes more than 120. 000 workers dispersed over the universe. Before long. Lockheed is one of the biggest resistance temporary workers known to man and appreciates about boundless requests over the universe. The tasks of the organization are separated into various segments comprising electronic frameworks ( 27 % ) . astronauticss ( 27 % ) . data frameworks and planetary arrangements ( 27 % ) and endless frameworks ( 19 % ) . Today. US specialists contracts represent a great part of the corporationââ¬â¢s net while remote specialists contracts other than make up a critical segment of the gross. On the different manus. orders from business customers simply make up a negligible 2 % of the whole gross the enterprise cyberspaces in a twelvemonth. In 1996. the partnership concluded the projects to get Lorad Corporation which later became bit of the enterprise at an expense of $ 9. 1 billion. Like some other planetary company arraigning 1000s of workers over the universe. Lockheed is definitely confronted with a bunch of difficulties that normally characterize concern tasks in the current universe. Perhaps the best test standing up to the company is the interest to go to worker concerns and effectually embrace the features of representative and modern dealingss without numerous employments like is ever the occurrence. On specific cases the partnership has needed to stand up to the test of striking specialists and travel delayed as representatives griped about arranged features partner to their tasks in the association ( Terris. 2010 ) . In that regard. the aspect of covering with these worker concerns has been one of the best representative difficulties affecting the association. Like most specialists in the business. a large portion of Lockheedââ¬â¢s laborers are unionized under the International Association of Machinists and Aerospace laborers and are ever segment and bundle of the exercises guided by the affiliation. The International Association of Machinists and Aerospace Workers is a laborer association. which attracts its starting 1888 when a gathering of 19 mechanics met up and framed the Order of the United Machinists and Mechanical Engineers. With cut. the little association developed in rank and embraced the current name. The association has had a problematic history portrayed by the developing of work movements in the twentieth century. The developing of the fraternity went pair with the improvement of the transport business all through the mature ages as an ever increasing number of laborers got utilized in the business. During its arrangement. the association was all things considered a mystery matter given that businesses of the clasp were extremely basic and unfriendly toward sorted out work movements. Be that as it may. the Order immediately spread past its arrangement zone of Georgia and was in the blink of an eye a perceived issue in the United States. A significant part of the developing in the position of the fellowship was to a great extent confirm during the World Wars when laborers in the movement business expanded inferable from the expanded interest of vehicles and planes ( Cimini. 1994 ) . In the class of the seventiess. the fraternity was divided into a few divisions covering with explicit issues affecting the individuals. These included social equality. framing. more established laborers and resigned laborers and grown-up females. At a convection held in 1984 in Seattle. Washington. the representatives casted a ballot and chose to use the Placid Harbor Education Center so as to create and teach the individuals from the fraternity. In 1998. the inside was renamed to the Winpisinger Education and Technology Center so as to recognize and respect the late leader of the fraternity. Since forever. the fellowship has ever tended to the issues affecting the laborers and haggled with the important bosses on explicit features partner to the open help of the representatives Contract Management. 2010 ) . More than 3000 specialists of Lockheed Corporation are unionized under the IAM and are ever in way with the work fellowship. The fellowship has ever haggled in a few cases sing the open help of the laborers of Lockheed. In 2009. IAM went under much discourse with the heading of Lockheed at Fort Worth where the company makes planes. The issues at show in that occurrence were human services expenses and benefits where the laborers were more than 3. 900 individuals in whole opposition with the course of the organization. At a reference to the laborers on nineteenth April. 2009. IAM President guaranteed the laborers that the fraternity would distinctly haggle for an equitable and just agreement between the individuals and the heading of Lockheed ( Julian A ; Denver. 2011 ) . The core of the issue in this regard rose out of the assurance by Lockheedââ¬â¢s bearing to signify that it would smother benefits plans for recently recruited employees and would other than increment human services costs for all the laborers at the corporationââ¬â¢s Fort Worth works. The IAM Negotiating Committee guaranteed that it would effectually go to the issue with the gatherings and cautioned Lockheed against its off base moves. There were other than claims that the organization was be aftering to introduce extremely costly social insurance programs if the laborers dismissed the idea of riddance of the so present human services program ( Sears. 2006 ) . In the class of the discourse. the fellowship foiled the endeavors by the organization to keep up the procedures off from the laborers. They inconsistently educated the laborers on whatever was transpirating among them and the heading. A lot of this endeavor was supplemented when the fraternity made a site from where data partner to the originating before arrangements was posted and the laborers could simple follow. The fellowship sorted out a progression of commissions to deal with the varying coordinations of the work stoppage and to keep up the representatives each piece great as the people great educated regarding the procedures. A few commissions came into arrangement. counting the work stoppage commission. conveying. network administration. film group and kitchen ( 2010 ) . These commissions were generally helping the fellowship functionaries thus toing the test of the exchanges given that the people and the specialists had extremely specific inclusion in the entire situation. In the class of the exchanges. the fellowship functionaries introduced the bearing of the partnership with a monetary counter proposition. The bearing should go over the proposition and react to the varying requests that were along these lines tended to. In the wake of going through the substance of the proposition. the functionaries of the association welcomed the fellowship functionaries to the bartering plain exhibit. In their announcements. the bearing articulated that their program to remove the benefits for the fresh recruits was just fitting and was on a very basic level a method of turn toing the difficulties the association was defying at that cut. In the strategy. it gave the idea that the heading of the partnership was extremely inflexible and did non want to yield land on the bartering plain cluster. While the course asserted that they truly paid their laborers great and they could in this way manage the cost of the new proposition it was seting frontward. the fraternity individuals completely dismissed the impression as giving through one manus and pickings by the other which was in a general sense exploitative in concern design. As bit of the underlying discoursed. the heading of Lockheed affirmed that it had given the fraternity the choice of tolerating a 3 for each centum pay rise expansion for the provisional laborers who were standing up to the test of the medicinal services program ( Boyne. 2010 ) . Besides. extra buying in fillip of $ 3. 000 was other than offered per specialist as part of the exchange. This was to be enhanced by $ 800 to cover the one-year expansion in the expense of life in the United States. Blending to the course. this was in a general sense to be a consequence program so as to go to the cardinal issue at manus and empower the laborers to come back to their work. In a similar technique. Lockheed was going up against comparable power per unit region from Pentagon and was sincerely in an opening to acknowledge the recommendations of the fellowship. It was. all things considered. a blow for the organization when the fraternity functionaries completely dismissed the projection programs on the history that they had neer been effective in the days gone by and that the organization had ever non respected such obligations ( Anderson. 2009 ) . In vengeance. Lockheed made the position that it could effectually go on its tasks absent a lot of regard to the nonionized laborers who were looking for a change of the human services programs. The enterprise reported that the mployed laborers would effectively supplant the nonionized specialists in the class of the activities ( IAMAW. 2012 ) . For a piece. in the midst of the discourse exchanges. it gave the idea that the work stoppage was actually an imperishable issue given that most activities in the enterprise had started restarting in spite of the emotional nonionized individuals. It was unquestionably a blow and an extraordinary test to the discourse method and it made the interest for f arther dealings and steps to go to the situation. The developing situation gave the fellowship functionaries a bunch of difficulties and they selected to look for exchange steps of activities while go oning with the
Saturday, August 22, 2020
Governance in the CNMI Essay -- Unicameral, Bicameral, legislature, Uni
Is the Commonwealth of the Northern Mariana Islands (CNMI) even better with a Unicameral Legislature or with the current Bicameral Legislature? As per Wikipedia, the Northern Mariana Islands Commonwealth Legislature is characterized as the regional assembly of the United States of America (Wikipedia). The administrative part of the Marianas is bicameral. It comprise of twenty individuals in the lower House of Representatives, and an upper house Senate with nine individuals. The Representatives serve two-year terms, and the Senators serve four-year terms, both without term limits. The two places of the governing body assemble and lead their gatherings on the Island of Saipan, the capital island of the Northern Mariana Islands. The House seats are chosen in seven regions. Two regions have one seat every, one for Tinian and Aguiguan, and one for Rota. The staying five regions choose various individuals, two with three individuals and two with six individuals which are completely situated in Saipan. As indicated by the Mariana Islands Constitution, the prerequisites for House of Representative are a base age of 21, must be a habitation of the Commonwealth for at any rate three back to back years, and an enrolled voter in the region you spoke to. Reapportionment happens like clockwork following the registration. Along with the Senate, the Constitution allows the Legislature to sanction a higher habitation prerequisite (CNMI Government laws). The Senate seats are separated into three locale containing three seats each from Saipan, Tinian, and Rota. The Senate seats are partitioned into two classes that are like the classes of the United States Senate. One class comprising of a solitary Senator from each locale, and the below average comprising of two Senators from... ... Mariana Islands, 1998- 2013. Web. Recovered from http://www.nationsonline.org/oneworld/northern_mariana_islands.htm Republic of the Northern Mariana Islands Country Brief. Landing page. Respective, Sept. 2013. Web. Recovered from http://www.dfat.gov.au/geo/cnmi/ Farrell, Don. ââ¬Å"Tinian: A Brief History.â⬠Tinian. (Unique work distributed 2012) Northern Marianas Commonwealth. Landing page. Council, 2006. Web. Recovered from http://www.cnmiago.gov.mp/government.html Pledge of the Commonwealth of the Northern Mariana Islands. Landing page. Web. Recovered from http://en.wikipedia.org/wiki/Northern_Mariana_Islands Pledge. Law correction commission, 2013. Landing page. Web. Recovered from http://cnmilaw.org/cnmicovenant.html Farrell, Don. Individual Interview. 26 Nov. 2013 Cruz, Peter. Individual Interview. 29 Nov. 2013
Saturday, August 15, 2020
Pros and Cons of Longitudinal Research
Pros and Cons of Longitudinal Research Student Resources Study Guides and Tips Print The Pros and Cons of Longitudinal Research By Kendra Cherry facebook twitter Kendra Cherry, MS, is an author, educational consultant, and speaker focused on helping students learn about psychology. Learn about our editorial policy Kendra Cherry Updated on September 17, 2019 SSteve McAlister/The Image Bank/Getty Images More in Student Resources Study Guides and Tips APA Style and Writing Careers In This Article Table of Contents Expand Overview Types Pros Cons View All Back To Top Longitudinal research is a type of correlational research that involves looking at variables over an extended period of time. This type of study can take place over a period of weeks, months, or even years. In some cases, longitudinal studies can last several decades. How Longitudinal Research Works So why would researchers want to conduct studies that take a very long time to complete? One reason is that a longitudinal study can be used to discover relationships between variables that are not related to various background variables. This observational research technique involves studying the same group of individuals over an extended period. Data is first collected at the outset of the study, and may then be repeatedly gathered throughout the length of the study. Doing this also allows researchers to observe how variable may change over time. For example, imagine that a group of researchers is interested in studying how exercise during middle age might impact cognitive health as people age. The researchers hypothesize that people who are more physically fit in their 40s and 50s will be less likely to experience cognitive declines in their 70s and 80s. The researchers obtain a group of participants who are in their mid-40s to early 50s. They collect data related to how physically fit the participants are, how often they work out, and how well they do on cognitive performance tests. Periodically over the course of the study, the researchers collect the same date from the participants to track activity levels and mental performance. A few key things to remember about longitudinal studies: They are observational in natureThey are a type of correlational researchLongitudinal research is often contrasted with cross-sectional researchLongitudinal research involves collecting data over an extended period, often years or even decadesCross-sectional research involves collecting data at a single point in time Types of Longitudinal Research There are three major types of longitudinal studies: Panel Study: Involves sampling a cross-section of individuals.Cohort Study: Involves selecting a group based on a specific event such as birth, geographic location or historical experience.Retrospective Study: Involves looking to the past by looking at historical information such as medical records. The Benefits So what are some of the reasons why a scientist choose to conduct longitudinal research over other methods? For many types of research, longitudinal studies provide unique insight that might not be possible any other way. The benefit of this type of research is that it allows researchers to look at changes over time. Because of this, longitudinal methods are particularly useful when studying development and lifespan issues. Researchers can look at how certain things may change at different points in life and explore some of the reasons why these developmental shifts take place. An example of how this research can be used include longitudinal studies that look at how identical twins reared together versus those reared apart differ on a variety of variables. Researchers track these participants from childhood into adulthood to look at how growing up in a different environment influences things such as personality and achievement. Since the participants share these same genetics, it is assumed that any differences are due to environmental factors. Researchers can then look at what the participants have in common versus where they differ to see which characteristics are more strongly influenced by either genetics or experience. Because longitudinal studies take place over a period of years (or even decades), they can be very useful when looking at changes in development over time. Researchers can utilize this kind of research to establish a sequence of events when looking at the aging process. The Drawbacks As with other types of psychology research, longitudinal studies have both their strengths and weaknesses. There are some important advantages to conducting longitudinal research, but there are also a number of drawbacks that need to be considered. Longitudinal Studies Can Be Expensive Longitudinal studies require enormous amounts of time and are often quite expensive. Because of this, these studies often have only a small group of subjects, which makes it difficult to apply the results to a larger population. Another problem is that participants sometimes drop out of the study, shrinking the sample size and decreasing the amount of data collected. Participants Tend to Drop Out Over Time This tendency for some participants to be more likely to drop out of a study is known as selective attrition. In our example above, participants might drop out for a number of reasons. Some might move away from the area while others simply lose the motivation to participate. Others might become housebound due to illness or age-related difficulties, and some participants will pass away before the study is concluded. In some cases, this can lead to an attrition bias and influence the results of the longitudinal study. If the final group no longer reflects the original representative sample, this attrition can also threaten the validity of the experiment. Validity refers to whether or not a test or experiment accurately measures what it claims to measure. If the final group of participants is not a representative sample, it is difficult to generalize the results to the rest of the population. The Worldâs Longest-Running Longitudinal Study The worlds longest-running longitudinal study is the Genetic Studies of Genius, which is today referred to as the Terman Study of the Gifted. The study was originally started in 1921 by psychologist Lewis Terman to investigate how highly intelligent children developed into adulthood. The study is still going on today, although the original sample has understandably grown much smaller. The study originally had over 1,000 participants, but that number had dwindled to just 200 by 2003. Some of the participants included scientist Ancel Keys and educational psychologist Lee Chronback. Researchers plan to continue the study until the last participant either drops out or dies. A Word From Verywell A longitudinal study can provide a wealth of information on a topic. Such studies can be expensive, costly, and difficult to carry out, but the information obtained from such research can be very valuable.
Sunday, May 24, 2020
A Response to Suze Ormans Article Essay - 935 Words
A Response to Suze Ormanââ¬â¢s Article In ââ¬Å"How to Take Control of Your Credit Cardsâ⬠, CNBC host and bestselling author Suze Orman provides her professional opinion on how the we can take responsibility and eliminate credit card debt. With Ormanââ¬â¢s advice and a little discipline all debts, either by choice or circumstance, can be cleared up in as little as just a few months. To start taking control of your debts you must learn to bring your interest rates down, protect those new low rates, and possibly seek help extra help through a credit counselor. First, she encourages everyone to try bringing their rates down ââ¬Å"as low as possibleâ⬠. Orman explains how it can be easy to negotiate a lower rate with your current card issuer if you carry atâ⬠¦show more contentâ⬠¦In her article she relies mostly on tips and tricks she has picked up throughout the years in her career. While it might seem that a lot of the advice given in the article is common sense and widely available to the public, Suze can convey her message in a way that is more relatable to the average person. From the voice in her article to the simplicity of her ideas; everything is laid out on the table for us to easily work with. The public may know these solutions are out there, but using her celebrity, she can inform us in a more personal level simply because she is a familiar face millions of people will see on television. I personally havenââ¬â¢t had the pleasure of sitting at the table for hours at a time, shuffling my accounts around so I could p ay off one debt with another. I did however get a front-row seat when my brother was caught up with his credit card bills. This was at a time when 16 year-olds with expensive taste and very little income were receiving pre-approved credit card already with their names printed on them. After my mom rejected him countless amounts of times he sent in his application without her knowledge. The changes began almost instantaneous. On Saturday he received his card and started out small. A couple new pairs of jeans and a few Polo shirts were added to his closet. Then on Sunday, he
Wednesday, May 13, 2020
Colleges for the Health Care Professions 2019
Universities that have teaching hospitals are typically connected with nursing school and medical schools. The variety of other disciplines in the health care field do not require six years of study or a degree from a university. Online colleges as well as traditional colleges and universities have been the means through which medical technicians and other support staff, and non-medical administrative professionals have started their careers. Trade schools and specialty institutions provide certification for individuals who are interested in careers as dental technicians, x-ray technicians, and nursing assistants. There are many courses of study available through online schools and traditional colleges for those interested in health management positions. Health administration degrees at any post-secondary level are available through the University of Phoenix Online. There is a comprehensive list of professional opportunities provided by their online program. Phoenix offers several different nursing degrees, including Health Care Education, Integrative Health Care, Health Care Management and a dual Masters degree in Nursing and Business Administration. They also provide a curriculum for a doctorate in Health Administration and nurse practitioner program. .u5bd63dc3b2588b6025ce33ba51587463 { padding:0px; margin: 0; padding-top:1em!important; padding-bottom:1em!important; width:100%; display: block; font-weight:bold; background-color:#eaeaea; border:0!important; border-left:4px solid #34495E!important; box-shadow: 0 1px 2px rgba(0, 0, 0, 0.17); -moz-box-shadow: 0 1px 2px rgba(0, 0, 0, 0.17); -o-box-shadow: 0 1px 2px rgba(0, 0, 0, 0.17); -webkit-box-shadow: 0 1px 2px rgba(0, 0, 0, 0.17); text-decoration:none; } .u5bd63dc3b2588b6025ce33ba51587463:active, .u5bd63dc3b2588b6025ce33ba51587463:hover { opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; text-decoration:none; } .u5bd63dc3b2588b6025ce33ba51587463 { transition: background-color 250ms; webkit-transition: background-color 250ms; opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; } .u5bd63dc3b2588b6025ce33ba51587463 .ctaText { font-weight:bold; color:inherit; text-decoration:none; font-size: 16px; } .u5bd63dc3b2588b6025ce33ba51587463 .post Title { color:#000000; text-decoration: underline!important; font-size: 16px; } .u5bd63dc3b2588b6025ce33ba51587463:hover .postTitle { text-decoration: underline!important; } READ The Doctorate in Education Educational LeadershipQuite a few health care career options are covered by Colorado Technical Universitys programs, and a majority of them are available online. The degree programs that they offer include Health Information Technology, Health care Administration, Massage Therapy, Medical Assistant, Nursing, Practical Nursing, Radiography and Surgical Technology. Westwood College offers online degree programs in some levels of health care management, medical insurance coding and billing, and other degrees in medical assisting. Another online college is CDI College that offers specialized programs that prepare students for the medical support field. Programs at CDI College include training for two types of medical office staff jobs, medical laboratory assistants, medical assistants and massage therapists. Certification for several different positions like orthopedic assistants, occupational therapy, childcare assistants. This school also offers nine different classifications of dental office worker programs online. Cappella University offers about twenty degree programs in psychology, counseling, health related social work, and health care administration. Their programs concentrate on therapy and counseling. They even have a curriculum for family therapy and marriage counseling, as well as school and sports psychology. .ua32cbf1c5bd70e9e43388c9409aa2d88 { padding:0px; margin: 0; padding-top:1em!important; padding-bottom:1em!important; width:100%; display: block; font-weight:bold; background-color:#eaeaea; border:0!important; border-left:4px solid #34495E!important; box-shadow: 0 1px 2px rgba(0, 0, 0, 0.17); -moz-box-shadow: 0 1px 2px rgba(0, 0, 0, 0.17); -o-box-shadow: 0 1px 2px rgba(0, 0, 0, 0.17); -webkit-box-shadow: 0 1px 2px rgba(0, 0, 0, 0.17); text-decoration:none; } .ua32cbf1c5bd70e9e43388c9409aa2d88:active, .ua32cbf1c5bd70e9e43388c9409aa2d88:hover { opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; text-decoration:none; } .ua32cbf1c5bd70e9e43388c9409aa2d88 { transition: background-color 250ms; webkit-transition: background-color 250ms; opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; } .ua32cbf1c5bd70e9e43388c9409aa2d88 .ctaText { font-weight:bold; color:inherit; text-decoration:none; font-size: 16px; } .ua32cbf1c5bd70e9e43388c9409aa2d88 .post Title { color:#000000; text-decoration: underline!important; font-size: 16px; } .ua32cbf1c5bd70e9e43388c9409aa2d88:hover .postTitle { text-decoration: underline!important; } READ BSN in Nursing Look for This to Avoid Enrolling in a Bogus Nursing ProgramIt is obvious that trade schools and online colleges have many programs with narrow focuses. There is health care training at every type of institution, and a good number of them are available through online programs. A broad number of specialties and associates bachelors, masters and even doctorate degrees are available online and on campuses. Related ArticlesGetting Your Health Care Management EducationGetting a College Education OnlineNursing and Health Care DegreesOnline Degree Options in Health CareRN to Bachelor of Science in Nursing 10 Highest Paying Nursing Specialties in ColoradoAcquiring a Health Care Degree on the Internet
Wednesday, May 6, 2020
Massacre of the Dreamers Free Essays
Ana Castillo, the author of ââ¬Å"Massacre of the Dreamers: Essays on Xicanismaâ⬠explores the 500-year old roots of Chicano feminism in America. Her collection of short essays dedicated to the issues of Xicanisma is aimed to denounce discrimination, the stereotypes and exploitation of Chicanos in the U.S. We will write a custom essay sample on Massacre of the Dreamers or any similar topic only for you Order Now She begins her collection of essays by the phrase ââ¬Å"I am a brown woman, from the Mexican side of townâ⬠and continues the confession with the astonishing confession, ââ¬â ââ¬Å"At an early age we learn that our race is undesirableâ⬠(Castillo, 1994). Chicanos ââ¬Å"have been marginalized in every sense of the word by U.S. societyâ⬠(Castillo, 1994). Probably, it seems too terrible to be true, but this what Ana Castillo asserts. The writer imitates no standard and generally accepted literary style of those times. The essays have no lack in tension, strength and dynamics. Ana Castillo doesnââ¬â¢t deviate from the theme, despite being limited by gender bounds. This woman wrote the book in the course of important cultural and social changes; therefore Massacre of the Dreamers deserves detailed exploration. It is apparent, that Mexican-American literature cannot but place emphasis on social, feminist and racial issues. In this regard Castilloââ¬â¢s collection of essays can be called a perfect example of the literature of ââ¬Ëresistanceââ¬â¢. Ana Castillo tells not only about the loss of culture and land, but also the role offered to Mexicans. The ââ¬Ëpromised paradiseââ¬â¢ turned into the land of changes and struggle for national identity. Ana Castillo evidently created her unique literary work at the intersection of numerous factors of social, political and cultural life at that time. The ââ¬Ëhistorical chronicleââ¬â¢ brings the reader closer to the understanding of deep philosophical, social and political conflicts, patriarchal prejudices, gender stereotypes, nationalism, racism, the interests of influential academic structures of American society and mass media. Massacre of the Dreamers is notably complex, contradictory and ambiguous; it reflects the change in stereotypes, transformation of cultural and social space in U.S. The success of Castilloââ¬â¢s book can be explained not only by the ability of the author to tell the stories of Chicano movement, but, above all, by the ideological pathos of her essays. Ann Castillo tells the stories of discrimination and racism. She reminds that changes in social status and structure of people of Mexican origin created social and political prerequisites for mass movement of protest ââ¬â Chicanos. The Chicanos movement was shaped in the image and likeness of any other movements; the ideology was based on the fact that Mexican Americans were people deprived of right for their territory. These people were treated like the objects of political and economic exploitation, and the second-rate nation. The writer dwells on inequality in economic, social, political and cultural life of America, on long-standing discrimination in sphere of employment, focusing attention on high unemployment and crime rates, to mention a few. Ann Castillo dwells on the issues of language discrimination. Although Mexican Americans spoke Mexican language, in contrast to other ethnic groups, the system of education refused to take into account the peculiarities of ââ¬Å"Spanglishâ⬠nation. The vast majority of Chicanos had to leave schools with no education necessary to get a qualified job. The language barrier was the main obstacle on their way. Ann Castillo brings the understanding that Chicanos accepted no ââ¬Ëmelting potââ¬â¢ theory, according to which Mexican Americans had to refuse from their culture, language and traditions. The writer presents a proof of revolutionary consciousness and testimony, signaling real hope and inevitable changes. She even criticizes a ââ¬Ëwhite feminismââ¬â¢, traces ancient Mediterranean roots for machismo, explores the moral dualism, repression of sexuality, and fear of death. Ann Castillo demands justice, writing that ââ¬Å"When we profess a vision of a world where a woman is not raped somewhere in the United States every three minutes, where one of every three female children does not experience sexual molestation, where the Mexican female is not the lowest paid worker in the United Statesââ¬âwe are not male-bashing or hating whites because overall they live a healthier life than we do, we are trying to change the facts of our conditionâ⬠(Castillo, 1994). Massacre of the Dreamers can be compared with an ââ¬Ëalternativeââ¬â¢ letter, which is set off against patriarchal culture of that time. Ann Castilloââ¬â¢s literary style is a multilevel and dynamic system. The basis of her writing is feminist social and even literary movement, as well as radical changes in social conscience, attempt to overcome ââ¬Ëmasculineââ¬â¢ diktat, racism, the feeling of inferiority, gender stereotypes and clichà ©s. It seems that the writerââ¬â¢s main idea is to offer the alternative ââ¬â not a mere equality, but creative cooperation and complementarity of cultures. Ann Castillo treads on forbidden ground. She dwells on problematic relationships between Chicanos and Americans, the issues of power and superiority of nations. She tells on correlation between racism both in literature and real life. The writer criticizes patriarchal culture with its racistââ¬â¢s values, and places emphasis on the necessity of self-realization through creative work. She strives for language expressiveness and makes an effort to create the independent Mexican American character. Massacre of the Dreamers sends a challenge to traditions, rules and stereotypes. Probably, she is not the first writer, who tries to express the history of Mexican Americans in U.S. but she is the first feminine writer, presenting a collection of the most acute and detailed literary confessions. Ann Castillo created the most brilliant and sometimes ironical essays. Although she writes from a palette consisting almost exclusively of grey and mud brown gloomy tones, she is extremely frank describing all nuances of Chicanos and their movement, their desires, fears, emotional experiences and doubts. References Castillo, A. (1994). Massacre of the Dreamers: Essays on Xicanisma. Albuquerque: University of New Mexico Press. How to cite Massacre of the Dreamers, Essay examples
Monday, May 4, 2020
Impromptu Speaking Feedback free essay sample
John Boyd Impromptu speaking is not too bad Just trying to come up with a topic was a little anxiety. The feedback received was good they advised me I was very informative on my topic and my voice first was a little low, but once I got in to my speech it was better. I believe that my hardest part is dealing with certain words to pronounce and topics I do not know anything about when giving a speech.I do feel I need to improve myself more concerning making speeches. I need to put more time on my preparation before my speeches, but sometimes there is not enough time, depending on the topic. Some speeches take longer than others Just depend on the speech and how long it needs to be. One thing I have learned with words I have trouble with is to draw a line between the letters to split them up when trying to say the word helps me. We will write a custom essay sample on Impromptu Speaking Feedback or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page I have had many experiences when it comes to concerning public speaking In my past that has helped me throughout the years at the beginning I was very shy and was afraid to even talk In front of people. Since then I have done several presentations at schools and other public places like projects working with senior citizens were had to present my project In front of them and relate to the fire apartment, and it was also put In the local newspaper.I have also been a trainer for a few years with the company I work for that has helped me. I still get nervous when I do have to speak In front of people, afraid of forgetting what I am supposed to discuss or not saying certain words correctly. My memory Is not that good sometimes especially short memory because of my dillydally but I try my best. Note cards are easier they are a gulled to help present my speeches. I hope to learn more ways on how to give better speeches In this course and to Improve my confidence.
Saturday, March 28, 2020
APA Critical Analysis Essays - Educational Psychology,
APA Critical Analysis: Teaching Students How to Learn Vol. 31, No. 6, June 2000 In "Teaching Students How to Learn" it showed the correlation between high-achieving students and their self monitoring in classes. The article goes on to say that unlike high school, college students do not have the regulation in their classes. A lot of the students do not know how to learn and set goals for themselves. Those students who highly monitor themselves tend to also have higher academic success. The article goes on to suggest that professors teach the students how to learn for themselves and set goals. Professors say that with the amount they must already teach there is not enough time to through in this new material. It is beneficial for college students to learn to learn, but many students lack the motivation behind this. A major problem with the study is looking at the motivation of the students. Many students are in college just for the good times, and not looking at the educational aspects. It should not be on the professors shoulders to baby-sit their students. A separate class could be offered on learning to learn for students wishing to take it whom are wanting to become higher achievers.
Saturday, March 7, 2020
Food safety management systems Essays
Food safety management systems Essays Food safety management systems Essay Food safety management systems Essay 1.1 Enterobacteriaceae An increased consciousness and a better apprehension of the nutrient industry and its associated hazards with microbiological taints have been the consequence of the broad usage of nutrient safety direction systems in Ireland. Hazard Analysis Critical Control Point ( HACCP ) is the chief nutrient safety system used throughout nutrient industries. Although this system was introduced in the 1960 s it was merely in 1998 that the EU Hygiene of foodstuffs Regulations implemented this referential in all nutrient concerns in Europe ( Food Market Exchange 2001 ) . Microbiological controls are performed to guarantee the quality and safety of the nutrient merchandises. The patterned advance in scientific discipline and microbic engineering hold given a better apprehension of nutrient production, processing and saving and the nexus between the microscopic and macroscopic universe. This relation enables micro-organisms to be exhaustively examined and evaluated. Food borne unwellnesss are the mos t widespread public wellness jobs, making societal and economic loads along with human enduring. In order to seek cut downing the hazard of such unwellnesss and nutrient poisonings, hygiene steps are required in nutrient processing environments ( Microbiological hazard appraisal 2006 ) . The presence of Enterobacteriaceae in nutrient or food-contact surfaces in such environments serves as hygiene indexs. : Enterobacteriaceae are a big household of bacteriums that comprise of at least 34 genera, 149 species and 21 races. Cells are typically 0.3-1.8Aà µm in length. ( Blackburn day of the month? ) They are rod shaped, Gram negative facultative anaerobes and are natural dwellers of bowels in both worlds and animate beings. They are found extensively throughout the dirt, H2O, on fruit, veggies and cereals. They play a considerable function in human wellness as many pathogens fall under this household which are known to do many infective diseases. Harmonizing to Kang et Al ( 2007 ) a minute sum of 10 settlement organizing units ( CFU s ) of peculiar micro-organisms can take to life endangering infections particularly in the immune-compromised. Salmonella typhimurium is responsible for typhoid disease while Escherichia coli is a common cause of stomach flu. ( Becker et al 2008 ) . Other Enterobacteriaceae associated diseases include infirmary acquired pneumonia, blood stream infections such as bacteraemia and blood poisoning, urinary piece of land infections and intra abdominal infections ( Denton 2007 ) . Enterobacteriaceae have been preponderantly associated with nutrient pathogen eruption. As discussed by Reilly et Al ( 1988 ) 224 eruptions of salmonellosis associated with domestic fowl meat were reported in Scotland entirely between 1980 and 1985. Among the 2245 people infected 12 died. Salmonella typhimurium and Salmonella enteritis were the chief serotypes associated with the eruption. In recent old ages the serotype Enterobacter sakazakii now known as Cronobacter sakazakii been identified as an emerging pathogen. It has been found in infant milk expression and has been the cause of neonatal meningitis and sepsis. It targets immune-compromised babies and those with a low birth weight. ( Van Acker et al 2000 ) In the 1920 s coli-aerogenes ( coliform ) group was indispensable as an index in the proof of equal processing processs in the dairy industry i.e. Pasteurization of dairy merchandises. It is apparent that since the 1950 s the full Enterobacteriaceae household has been preferred over other taxons as marker beings as they are known to be better defined when it comes to their finding and the household includes more beings of significance than other households. In the 1980 s Escherichia coli was foremost used as a mention being in the monitoring of imbibing H2O supplies. ( Mossel and Stryijk 1995 ) A microbic index harmonizing to Moore and Griffith ( 2000 ) is a microorganism that is an index for the possible presence of pathogens. 1.2 Adherence of Enterobacteriaceae to surfaces. The adhesion of micro-organisms to surfaces in the nutrient industry chiefly on treating equipment is one of the major concerns in the equal control of quality and safety of nutrient merchandises. If cleansing and sanitation are deficient, micro-organisms on the surface can last by the development of a biofilm. ( Ortega et al 2009 ) . A biofilm reduces susceptibleness to disinfectant and increases polysaccharide production. The happening of a biofilm can take to post processing taint taking to a lowered shelf life of a merchandise and the transmittal of diseases. In add-on it has been known to do mechanical obstruction, damage of heat transportation, addition in unstable frictional opposition and the corrosion of metal. ( Fuster-Valls et al 2007 ) To day of the month no ideal method for finding the cleanliness of surfaces has been available. The combination of ocular, non microbial and microbiological methods can take to an integrated cleansing monitoring scheme. ( Griffith et al 1997 ) . The ability to quantify micro-organisms on nutrient contact surfaces provides indispensable information for patterning consumer exposure from cross taint in the nutrient industry through nutrient production, nutrient conveyance and in nutrient service environments. Many infective bacteriums have been known to adhere to surfaces particularly unstained steel, glass and gum elastic. Stainless steel is used extensively throughout the nutrient processing and the nutrient conveyance industry. As described by Ortega et Al ( 2009 ) , unstained steel is most widely employed due to its mechanical strength, corrosion opposition and easiness of fiction . Despite looking smooth to the unaided oculus, when chromium steel steel is viewed under the microsco pe it is shown to be really unsmooth with many distinguishable defects. These defects are thought to harbor bacterial cells which with the add-on of H2O and foods would heighten the micro-organism s endurance ( Moore and Griffith 2002 ) . There have been limited surveies on the adhesion behavior on Escherichia coli on chromium steel steel. Ortega et Al ( 2009 ) stated 108cfu/ml of civilization on chromium steel steel for 2 H at 20à °C was under the sensing bound. In contrast another survey suggested 105cfu/cm2 were found on chromium steel steel after vouchers were inoculated with 108cfu/ml at 4 à °C for 24 H. 1.3 Sampling of surfaces with swabs and sponges. Harmonizing to Hall and Hartnett ( 1964 ) , a simple convenient sample process would be utile to trace path of infection , for the identification of human bearers, rating of decontamination processs and bacteriological surveillance of the environment which could hence take to in-service preparation of forces concerned with sanitation . Surface sampling is going progressively of import and legion probes have been afoot to happen a simple, dependable, bacteriological trial to find, quantitatively, the healthful quality of environmental, nutrient and hand-contact surfaces. ( Angelotti et al 1958 ) . Cleaning agendas in the nutrient industry are designed chiefly to cut down both nutrient dust and to decrease microorganisms to degrees that pose small or low hazard to both safety and the quality of the merchandise. ( Moore and Griffith 2002 ) Traditional swabs are made from a wooden or plastic shaft with cotton, rayon, Dacron, or alginate fibers which are spun organizing a bud at one terminal. Moore and Griffith ( 2007 ) discourse how the wetting agents applied to swabs have dramatic effects on the sum of bacteriums recovered from a surface. The chief points to be assessed in finding how effectual peculiar swab types are depend on the remotion of bacterial contaminations from a surface, the release of these bacteriums from the swab bud and the subsequent cultivation . It was found that cotton swabs absorbed more liquid than other swabs evaluated. When bacteriums were recovered from wet surfaces it was apparent that coppice textured, Rayon and Dacron tipped swabs removed a significantly fewer CFU s compared to the cotton swabs. It was shown how cotton swabs performed every bit every bit good when trying a dry surface. Moore and Griffith ( 2007 ) province that cotton swabs consist of a secondary wall that is made up of cellulose. This enables the cotton to swell when positioned in wetness to ensue in an increased soaking up of liquid together with bacteriums entrapped indoors. These positive features that enable cotton swabs to take high degrees of bacteriums from a surface are thought to impede the swabs release of the bacterium. It can be predicted that the usage of a swab with a hapless initial absorbency could later ensue in a higher overall bacterial recovery with the assistance of dilutants to ease bacterial release. Moore and Griffith ( 2007 ) besides discuss how it was apparent upon go forthing the swabs at room temperature for 24 H that the release of bacteriums from the cotton swab was greater than other swabs. It was apparent that the bacterium became entrapped within the cotton fibres hence protecting the bacterium and assisting to make a microenvironment enabling the bacterium to last. In contrast to Moore and Griffith ( 2007 ) statements, Copan Italia ( 2010 ) shows how unfastened cell froth swabs have good release of the bacteriums but demonstrated soaking up of 3-5 times less than in traditional fiber swabs due to their construction ( Figure 1 ) . The development of Flocked swabs which have good releasing belongingss and can absorb five times more than cell froth swabs are widely used in clinical nosologies but have nt been applied yet to the recovery of Enterobacteriaceae throughout the nutrient industry. 1.4 Biochemical trials for the sensing and quantification of Enterobacteriaceae and their restrictions. Current biochemical and civilization based checks tend to be cheap and comparatively simple nevertheless there are restrictions with such trials. One of the chief restrictions includes the length of clip that is needed for the sensing and numbering of bacteriums. False- positive consequences, the loss of viability of bacteriums from aggregation to its numbering and the deficiency of growing of feasible yet non cultural bacteriums have been associated with current biochemical and civilization based checks. ( Rosrak and Colwell 1987 ) Today the Gram discoloration process is of common usage in research labs as the first method of designation for a micro-organism. The method was originally published in 1883 by Hans Christian Gram. This technique nevertheless is nt ever demonstrative of true Gram nature. Some Gram positive bacteriums may stain Gram negative due to cell wall harm in the bacteriums by over exposure to O. ( Bahrani Mougeot et al 2008 ) Blackburn ( day of the month? ) stated that the proving for enteral pathogens such as Salmonella requires specific methods that are labour intensive and can take several yearss to finish. Furthermore, infective bacteriums in nutrient are frequently non homogeneously distributed and are present in low Numberss doing sensing hard. Many nutrient production sites chiefly prefer to prove for enteral pathogens in external research labs while the testing of E.coli and Enterobacteriaceae are routinely tested to supply convenient appraisal of possible fecal taint. Many methods published from International Organisation for Standardisation ( ISO ) methods are available, where many processs of sensing are quantitative. The bulk of nutrient makers impose acceptable bounds for a given micro-organism. The Most Probable Number ( MPN ) technique from ISO 4831:2006 ( ISO 2010 ) and plating utilizing pour or spread technique are chiefly used. Violet Red Bile Glucose Agar ( VRBGA ) and Violet Red Bile Agar ( VRBA ) incorporating lactose have been deemed the most popular media for analyzing nutrients for Enterobacteriaceae. Their sensing and numbering are based chiefly on their ability to bring forth acid and gas from the agitation of glucose and milk sugar which is detected by the pH index impersonal ruddy. An sheathing is recommended to guarantee agitation of the saccharides and to cut down the hazard of oxidization every bit good as bettering the specificity of these media and later cut downing intervention from background vegetations or motile strains ( Blackburn day of the month? ) . There has been grounds that non Enterobacteriaceae bacteriums can turn on VRBA and VRBGA hence proposing that this method can impede specificity. The growing of Aeromonas spp has been detected on VRBGA harmonizing to Petzel and Hartman ( 1985 ) and VRBGA has been seen to be insufficiently selective bespeaking 52.4 % of consequences obtaine d to be false- positive ( Wook Oh and Kang 2004 ) MPN methods can supply greater sensitiveness compared with plating techniques when the taint degrees are low. However if the concentration of taint is high the consequences show greater fluctuation and may take to false positive consequences. MPN technique consists of multiple tubings of different media including Buffer Peptone H2O, Enterobacteriaceae enrichment stock. ( See figure 2 ) Enterobacteriaceae are oxidase negative and this trial is used to prove for the presence of the enzyme cytochrome oxidase to corroborate presumptive settlements in correlativity with glucose agar trial which tests for agitation of glucose. If agitation occurs it consequences in abundant production of acerb terminal merchandises ensuing in a color alteration. This method required by ISO described by Rose et Al ( 1974 ) has low preciseness and inordinate clip is necessary for analysis runing from 5-7 yearss. APIaââ¬Å¾? designation systems from Biomerieux are used widely throughout research labs. ID32E, is a standardized system in which the designation of Enterobacteriaceae and other not fastidious Gram negative bacteriums can be quickly identified. Many surveies have been reported utilizing API as method of designation including those of Drudy et Al ( 2006 ) and Galani et Al ( 2007 ) . The API/ID32E sensing kit is the most extended of the scope of API merchandises available. It includes 15 designation systems covering all groups of bacteriums encountered in industrial microbiological research labs ( BioMerieux, 2010 ) . The dependability of APIaââ¬Å¾? designation systems it used throughout industries. Janda et Al ( 2001 ) stated nevertheless that the trials included in the API 20E strip in 1975 were still the same in 2001 even if the Numberss of taxons in the Enterobacteriaceae household has increased well between those old ages. The ready to utilize Petrifilm system has been released by 3M health care for the sensing of foodborne pathogens. It s easy to utilize technique comprises a selective media under a transparent movie ( 3M health care ) . The media is hydrated by the add-on of bacterial suspension and after incubation seeable settlements can be counted. ( Blackburn? ? ) Despite this method being speedy and convenient, Petrifilm systems are expensive. Restrictions of this technique discussed by Mueller et Al ( 2009 ) show that some settlements shown on Petrifilm are excessively little to see from bare oculus. Therefore the usage of magnification for accurate visual image is required. It was shown that some beings can liquefy the gel on the movie leting spreading of growing and subsequent harm to other bing settlements supplying a lower count of settlements. Standard methods such as conventional civilization and biochemical based checks used to recite necessitate 18-24 H for consequences to be obtained. Progresss in modern molecular biological science have seen the development of molecular checks such as the polymerase concatenation reaction ( PCR ) that have become highly dependable and important in the sensing of bacterial species ( Khan et al 2007 ) . 1.5 Alternate DNA- based method for the sensing and quantification of Enterobacteriaceae 1.51 DNA extraction The rules of DNA extraction as discussed by Jordan ( 2008 ) include the debasement of microbic cell wall to let go of the Deoxyribonucleic acid and to sufficiently take sample constituents which can cut down assay efficiency and degrade the Deoxyribonucleic acid. Due to the complexness of nutrients matrices there are many inhibitors of DNA extraction including saccharides, fats, proteins, metal ions, phenoplasts and cell dust. 1.52 Polymerase Chain Reaction Polymerase Chain Reaction ( PCR ) is one of the most widely used molecular biological science techniques in the research lab. This is due to its specificity, flexibleness, singular velocity and its resiliency ( Mc Pherson et Al 1995 ) . PCR was developed in the 1980 s and the technique has been continuously improved and modified to spread out its versatility and pertinence . This Deoxyribonucleic acid based method has become an indispensable and day-to-day performed experimental technique in many research Fieldss and clinical research labs to observe infective agents, to magnify familial stuffs from limited volumes of DNA sample ( Aà µl ) and for cloning for sensing of familial look degrees. ( Yang et al 2005 ) . PCR is utile for both the diagnosing and direction of a assortment of infective diseases. ( Louis et al. , 2000 ) PCR Mix: PCR mix is made up of DNA polymerase, a forward and a contrary primer, bases, a DNA Target and PCR buffer with MgCl2. PCR stairss PCR elaboration can turn a few molecules of a specific mark nucleic acid into a mcg of DNA. Roche PCR Applications Manual ( 2006 ) explained how the procedure of PCR occurs in three chief stairss of 1 ) Denaturation, 2 ) Annealing and 3 ) Extension with the usage of temperature cycling ( figure 3 ) . Denaturation occurs at 90à °C when heat separates double stranded DNA into two individual strands. Since the H bonds associating the bases to one another are weak they break at such high temperatures, whereas the bonds between the deoxyribose and phosphates which are strong covalent bonds remain integral. The end of PCR procedure is non to retroflex the full strand of Deoxyribonucleic acid but to retroflex a mark sequence of about 100-35,000 base brace that is alone to the being. Primers are used to specify the terminals of that sequence. Primers are short, man-made sequences of single- stranded DNA typically dwelling of 20-30 bases. The annealing measure takes topographic point between 40à °C to 65à °C depending on the length on the length and sequence of the primers. This allows the primers to temper specifically to the mark sequence. Once the primers anneal to the complementary DNA sequences, the temperature is raised to about 72à °C and DNA polymerase begins to synthesise new dual stranded Deoxyribonucleic acid molecules that are indistinguishable to the original mark DNA. It does this by easing the binding and connection of complementary bases that are free in solution ( dNTPs ) . Synthesis ever begins at the 3 terminal of the primer and returns entirely in the 5 to 3 way. The new synthesis efficaciously extends the primers, making a complementary two-base hit stranded molecule from a single-stranded templet. After the PCR procedure is complete, cataphoresis must be completed in order to For the sensing of bacteriums within nutrients the mechanism of PCR has proved to be really effectual. Low degrees of 3cells of Campylobacter were found in meat samples utilizing this technique ( Waage et al 1999 ) . However During PCR elaboration, short Deoxyribonucleic acid sequences are copied at each rhythm. Theoretically the sum of Deoxyribonucleic acid at each rhythm should duplicate at each rhythm, ensuing in an exponential elaboration of the initial mark DNA. Fraga et Al ( 2009 ) demo how this is potentially true during the early phases of the reaction when the constituents present in PCR are in huge extra compared to the mark sequence. As the merchandise accumulates, the substrates become low ensuing in suppression. In order to look at the efficiency of the reaction, PCR can be divided into three distinguishable stages: exponential, additive and tableland. The first stage is exponential stage in which the reaction is 100 % efficient with the doubling of merchandise at each rhythm. As the amplicon exponentially accumulates in measure the PCR constituents are used up and the primers begin to vie with the amplicon and the reaction efficiency later decreases. As the reaction slows down the additive stage begins. The merchandise formed in this stage is extremely variable due to the rate at which peculiar constituents are depleted and the accretion of merchandises. The tableland stage is when the reaction Michigans due to depletion of substrates and the suppression of merchandises. There is an highly big difference between the additive stage and the concluding sum of merchandise produced. In conventional PCR, sensing of PCR merchandise is completed late in the additive stage or at plateau stage. As seen in figure 5 there can be a distinguishable difference in the two stages demoing that conventional PCR is variable when it comes to quantitative consequences. 1.42 Real clip PCR The development of existent clip quantitative PCR ( QPCR ) presents more rapid, specific and quantitative numbering of peculiar mark cistrons as they are amplified in existent clip. In existent clip PCR the sum of merchandise formed is monitored during the class of the reaction by supervising the fluorescence of dyes or investigations introduced into the reaction that is relative to the sum of merchandise formed, and the figure of elaboration rhythms required to obtain a peculiar sum of DNA molecules is registered. ( Kubista et al 2006 ) . Real clip PCR checks are characterized by a broad scope of quantification of 7-8 logarithmic decennaries, high proficient sensitiveness, high preciseness and it does nt necessitate any station PCR steps hence the hazard of taint is reduced. ( Klein D 2002 ) Real clip PCR processs follow the same rules of conventional PCR in the readying of mixes and cycling of temperature. This rapid sensing method uses a sensing format, normally a fluorescent dye that binds to the PCR merchandise. The sum of fluorescence generated is relative to the sum of PCR merchandise formed. Initially the signal is weak and hence indistinguishable from the background but as the PCR merchandise accumulates, the fluorescence can be acquired by the existent clip PCR device. A threshold line is developed by the existent clip device and the CT value is determined. CT value is the figure of rhythms required to make fluorescent threshold. Real clip PCR generates a CT value for each DNA sample which is hence relative to the transcript figure DNA. Normally used fluorescent Reporters SYBR Green 1. Asymmetric cyanine dyes such as SYBR Green 1 have two aromatic systems incorporating N, one that is positively charged connected by a methine span. The dye has virtually no fluorescence when free in solution due to quivers prosecuting both aromatic systems, which convert electronic excitement energy into heat that dissipates to the environing dissolver. When the dyes bind with DNA they emit fluorescence. ( Nygren et al 1998 ) As disussed by LightCycler Rea clip PCR Systems ( 2009 ) , SYBR Green binds to all double stranded Deoxyribonucleic acid molecules irrespective of the sequence. When it comes into contact with dual stranded Deoxyribonucleic acid its fluorescence additions significantly. Harmonizing to Monis et Al ( 2005 ) SBYR Green 1 has a restriction in dye stableness and dye dependent PCR suppression and the selective sensing of amplicons during DNA runing curve analysis. HYBRIDISATION PROBES HYDROLYSIS PROBES TAQMAN PROBES LUX PRIMERS SYBR Green 1 is normally used in existent clip PCR. However, these asymmetric dyes nevertheless are considered sequence non-specific newsmans in real-time PCR. They tend to breathe fluorescence signal to all double stranded DNA even unwanted primer-dimer merchandises. Primer dimer merchandises interfere with the formation of specific merchandises due to competition of the two reagents and may take to wrong readings. Melting curve analysis can easy recognize primer-dimer formation. Temperature is increased and fluorescence is measured as a map of temperature. As temperature additions, fluorescence lessenings due to increased thermic gesture. When dual stranded DNA separates an disconnected bead in the fluorescent signal occurs. Since primer-dimers are shorter and they tend to run at a lower temperature, they are easy recognised in runing curve analysis. Light Upon Extension ( LUX primer ) : based on oligonucleotides labelled with a individual fluorophore. They do non necessitate a quencher mediety includes a single-labeled primer with a FAM fluorophore at the 3 terminal in a hairpin construction and a corresponding unlabelled primer, designed to amply the 5 terminal of the cistron encoding the S protein ofTGEV. The constellation of the labelled primer enables the fluorescence slaking capableness. When the primer is incorporated into double-stranded RT-PCR merchandise, the fluorophore is dequenched, ensuing in a important addition in fluorescent signal Unlike the current good known real-time engineering that relies on a man-made DNA investigation labeled with two different fluorescent dyes, LUX primers engineering does non necessitate an expensive investigation so is more suited for everyday research lab diagnosing. What a LUX check demands is a specific primer set with a individual labeled, self-quenched primer and a corresponding unlabelled one, it is more dependable than the real-time method usingDNA bindingdyes that may bring forth potentially deceptive consequences due to the deficiency of specificity of the dyes. A old survey besides indicates that the LUX primers engineering is dependable for quantitation of cistron look and the consequence is similar to the probe-based quantitative check ( Brian et al. , 2003 ) . LUX fluorogenic primers can be designed and ordered via online package. The LUX check besides has the advantage of addition velocity and is less arduous over the gel-based RT-PCR technique that is presently the everyday cistron analysis tool forTGEV. The LUX assay took less than an hr to finish the elaboration reaction and the procedure was viewed in existent clip, while conventional RT-PCR methods normally take more than 1h for cistron elaboration and half an hr or more to run the gel and analyze the consequence. The advantage of velocity of the LUX check is more evident when compared to other everyday diagnostic methods for TGE Furthermore, the LUX check is closed-tube and one-step technique, which reduces the hazard of taint and reaction variableness. This sensitive and specific trial complements bing cistron methods for the sensing ofTGEV. The method shall turn out to be a valuable tool in the research lab diagnosing ofTGEV, particularly as a agency of corroborating positive consequences from serological trials. LUX primers engineering supports manifold elaboration ( hypertext transfer protocol: //www.invitrogen.com/lux ) that makes observing different pathogens in a individual check possible. By utilizing two sets of primers, each labeled with a different dye, a individual LUX check can observe two different viruses. LUX primers are compatible with a broad assortment of real-time PCR instruments ( hypertext transfer protocol: //www.invitrogen.com/lux ) . More checks can be developed for the sensing of other pathogens. By cut downing the cost of real-time cistron sensing and with high public presentation, LUX fluorogenic primers engineering may has the possible to be used widely in the field ofanimal diseasesurveillance and control every bit good as import and export carnal quarantine direction. Advantages of utilizing DNA for microbic Testing Deoxyribonucleic acid is stable and unswayed by environmental factors while being independent from bacterial fundamental law doing consequences conclusive non subjective. It is accurate due to species specific mark sequence which is unattainable with cultural methods and public presentation controls can be added. There are good established DNA sensing methods available which enable fast sensing. Reliable industry of primers and investigations. 2.1 Preparation of Deoxyribonucleic acid from bacterial strains The undermentioned Enterobacteriaceae strains were obtained ( MicroBioLogics Inc, Minnesota, USA ) Escherichiacoli ( ATCC 11775 ) , Serratiamarcescens ( ATCC 13880 ) , Enterobacteraerogenes ( ATCC 13048 ) , Salmonella typhimurium ( ATCC 13311 ) Erwinia persicina ( ATCC 1381 ) Shigella flexneri ( ATCC 9199 ) Klebsiella pneumonia ( ATCC 700603 ) , Yersinia enterocolitica ( ATCC 9610 ) Listeria monocytogenes ( ATCC 19115 ) , Vibrio parahaemoliticus ( ATCC 17802 ) , Aeromonas hydrophila ( ATCC 7966 ) and Campylobacter jejuni ( ATCC 29428 ) . The University of Limerick supplied the strains Cronobacter sakazakii, Enterobacter cloacae, Pseudomonas aeruginosa and Proteus Mirabilis. The National Collection of Type Cultures ( Health Protection Agency Culture Collections, Salisbury, UK ) supplied Staphylococcus aureus ( NCTC 8325 ) . All strains of bacteriums were stored on Protect beads 109 ( LangenBach services Ltd, Dublin, Ireland ) at -20à °C until cultivation. All Enterobacteriaceae strai ns grown on alimentary agar ( NA ) ( Oxoid, Basingstoke, UK ) at 37à °C for 24hr Aà ± 2 hour except Erwinia persicina which was grown at 30à °C, Listeria monocytogenes and Staphylococcus aureus grown at 37à °C. Vibrio parahaemoliticus grown at 35à °C on Trypic soybean agar ( TSA ) ( Oxoid ) Confirmation and Identification of the mention micro-organism E coli. The designation of Escherichia coli ( ATCC 11755 ) was verified by the undermentioned biochemical trials. The Gram discoloration process was applied to a settlement from the fresh civilization on NA. Oxidase trial was carried out utilizing oxidase strips ( bioTRADING, Dublin, Ireland ) . A positive control of Pseudomonas aeruginosa and a negative control of Staphylococcus aureus were used to corroborate the dependability of the trial. API designation utilizing ID 32E was carried out harmonizing to maker s instructions ( BioMerieuxAà ®S.A, Craponne, France ) and identified utilizing the package Apiweb ( BioMerieux ) 2.2 Preparation of bacterial suspension. Pre-cultures were prepared by infixing a loop full of bacterial settlement into Nutrient Broth ( Oxoid ) with incubation of 37à °C for all Enterobacteriaceae with the exclusion of Erwinia persicina which was grown at 30à °C, Listeria monocytogenes and Staphylococcus aureus grown at 37à °C. A loop full of Vibrio parahaemolyticus was grown at 35à °C on Tryptic Soya Broth ( TSB ) ( Oxoid ) In peculiar the growing of Escherichia coli in alimentary stock was studied by mensurating the optical denseness and home base numeration. Spectrophotometric measurings were obtained at 600nm utilizing ( insert name here ) .Optical denseness was acquired every 30min from 0min to 4h 30min 2.3 Usual spiking of vouchers and recovery by swobing. Stainless steel vouchers of class 304 were obtained. Regions to be spiked with Escherichia coli were indicated utilizing a templet ( ) ( 10cm x 10cm ) . Each voucher was spiked by pipetting 100Aà µl of Escherichia coli civilization onto the surface and utilizing a spreader ( ) . After allocated clip ( 0min 30min or 60min ) , vouchers were swabbed utilizing cotton swab. Each voucher was swabbed twice: horizontally and vertically. Each swab was cut and placed into the interior tubing of swab extraction tubing system ( SETS ) ( Roche Diagnostics, Mannheim, Germany ) .Each aggregation tubing was later centrifuged at 10000g for 10min ( Sigma1-15 ) . Then the inner tubings and the supernatants were discarded. Pellets were re-suspended in 250Aà µl Ringer one-fourth strength solution ( Oxoid ) . Dilution series in one-fourth strength toller solution were prepared, plated out on alimentary agar and incubated 18-24h at 37à °C. 2.4 Study of the release of Bacteria from different swabs and sponges. Comparative survey of the recovery of Escherichia coli cells was performed utilizing cotton, rayon and alginate swabs. ( Copan Italia S.p.A, Brescia, Italy ) . 100Aà µl of 18h Escherichia coli civilization were deposited straight onto each swab. Swabs were cut and placed into SETS tubes. Tubes were centrifuged at 10000 g for 10 min. Pellets were re-suspended with 200Aà µl of quarter-strength Ringer Solution ( Oxoid ) . Dilution series were made and 100 Aà µl of diluted sample were plated onto alimentary agar home bases ( Oxoid ) that were incubated at 37à °C for 24 H. Large sponges ( Medical Supply Co Ltd, Dublin, Ireland ) were tested to retrieve bacteriums from surfaces by swobing after allocated clip ( 0 min, 30 min, 60 min ) . Each sponge impregnated with 10ml Maximal Recovery Diluent ( MRD ) ( Oxoid ) was inserted into a stomacher bag ( ) supplemented with 100ml of MRD and stomached utilizing stomacher ( ) for 120 s at high power. Dilution series were made and 100Aà µl of diluted sample was plated onto alimentary agar home bases ( Oxoid ) that were incubated at 37à °C for 24 H 2.5 Detection and Quantification of feasible bacteriums from surfaces. Plate numeration expression was obtained as per ISO 4833:1991 ( Harrigan W.F 1998 ) which has since been renewed to ISO 4833:2003 Microbiology of nutrient and animate being eating materials Horizontal method for the numbering of micro-organisms Colony-count technique . The home base numeration expression was? c/ ( n1 + 0.1 n2 ) vitamin D where? degree Celsius was the amount of all settlements counted on all dishes, n1 was the figure of dishes in 1st dilution, n2 was figure of dishes in 2nd dilution and vitamin D represented the dilution. Miles and Misra method as per Harrigan W.F ( 1998 ) was used in peculiar when proving recovery of Escherichia coli from the big sponges. 2.10 Bacterial designation of bacteriums in the suspension used to make the unreal nutrient environment on surfaces. The suspension was prepared from 34 swabs samples that were collected from nutrient contact surfaces in Dawn Fresh Food Company, Fethard, Co. Tipperary. Each swab was assorted with 0.1 % peptone H2O ( Oxoid ) and the suspension were pooled together to make one chief suspension that was assorted with half volume glycerol 50 % ( Sigma Aldrichaââ¬Å¾? Inc ) . This suspension was aliquoted into 1ml eppendorf tubings and maintain in at -80à °C. A entire feasible count was determined by utilizing the Miles and Misra method and later by home base numeration following a dilution series of bacterial suspension. The sensing of Listeria monocytogenes, Staphylococcus aureus and the Enterobacteriaceae were targeted. In the instance of Listeria monocytogenes 1ml of sample was dispensed into 9ml Buffer Peptone H2O ( Oxoid ) . Incubate 37à °C for 18-24hours. After 24 H transportation 10ml from tubing into 90ml of Listeria Enrichment stock ( Oxoid ) , incubate for 48 H at 30à °C guaranting agitation. After 48 h a loop full of solution was streaked on a Listeria agar home base ( Oxoid ) and incubated for 48 H at 30à °C. Listeria Petrifilm ( 3Maââ¬Å¾? , Dublin, Ireland ) was used following maker s instructions. For the designation of Staphylococcus 100Aà µl of unreal nutrient environment was plated on baird Parker agar ( Oxoid ) administering the organic burden throughout the home base utilizing a spreader and incubated at 37à °C for 48 h. After 48 h agglomeration was tested utilizing PastorexAà ® Staph Plus trial. ( Biorad ) . Catalase activity was tested by the add-on of H2O2 ( ) . Each suspected Staphylococcus aureus settlement was placed in 1ml of toller solution that was later pipetted on to Staph Petri movie ( 3Maââ¬Å¾? ) . Petri movie was placed in brooder for 24 H at 37 à °C. Enterobacteriaceae was detected utilizing most likely figure ( MPN ) See appendix. 2.6 DNA extraction: For specificity for PCR checks, bacterial pellets were obtained antecedently from civilizations in exponential growing stage were used with the exclusion of Camplyobacter jejuni. One settlement of C.jejuni was resuspended in 0.1 % Peptone H2O ( Oxoid ) and centrifuged at 5000 g for 5 min. For the quantification of bacteriums from surfaces, pellets were recovered from SETS after centrifugation of 1ml of civilization at 5000 g for 5 min. A rapid purification of DNA samples utilizing DNeasy Blood and Tissue Kit ( Qiagen, West Sussex, UK ) was preformed following maker s instructions. Deoxyribonucleic acid was extracted, purified and later quantified utilizing Nanodrop ND 1000 spectrophotometer ( ThermoScentific, Wilmington, USA ) Deoxyribonucleic acid concentrations were adjusted to 1ng per 2Aà µl 2.7 Choice of Primer sets. 2.7-1 ENT Primers ENT primers developed by Nakano et Al ( 2003 ) and designed to temper to the 16S rRNA cistron of Escherichia coli. The sequence of the forward primer: 5GTTGTAAAGCACTTTCAGTGGTGAGGAAGG 3was 425 through 454 in the E. coli 16S rDNA while the sequence of the contrary primer 5GCCTCAAGGGCACAACCTCCAAG 3 had places 826 through 848 in the E.coli 16S rDNA. ENT primers expected to take to formation of 419-425 bp of PCR merchandise. 2.7-2 IEC primers: IEC primers as described by Khan et Al ( 2007 ) are oligonucleotide primer braces derived from the distal and proximal conserved flanking parts of the16S rRNA cistron, the Internal Transcribed Spacer ( ITS ) part and the 23S rRNA.IEC frontward primer 5CAATTTTCGTGTCCCCTTCG 3 and change by reversal primer 5GTTAATGATAGTGTGTGTCGAAAC 3 had expected PCR merchandise length of 450bp. 2.8 PCR Conditionss For a individual PCR 25 Aà µl PCR reaction, PCR maestro mixes were prepared with unfertile DNA H2O, PCR buffer 2mM MgCl2, 25mM MgCl2, a dNTP mixture ( dATP, dTTP, dCTP, dGTP ) , frontward primer, change by reversal primer, DNA polymerase and 2Aà µl of peculiar DNA. PCR was carried out on G-STORM GS2 Thermal Cycler. ( Familial Research Instrumental Ltd, Braintree, UK ) . The elaboration conditions were as follow: stopping point palpebra and heated to 111à °C, 95à °C for 6 min, bacterial rhythm start of 28ycles, denaturation measure of 95Aà °C for 30 s, tempering temp between gradient of 56-62Aà °C depending on primer type for 15 s, elongation for 30 s at 72à °C. End rhythm with elongation for farther 7 min at 72à °C. Cycle was repeated 30 times. 2 % Agarose gel ( Biosciences, Dun Laoghaire, Ireland ) pre-stained with SYBR Safeaââ¬Å¾? ( Molecular Probes, Eugene, USA ) cataphoresis was run in Tris ethanoate EDTA ( TAE ) . ( Sigma Aldrichaââ¬Å¾? Inc, Saint Louis, USA ) with Amplisize ( Biorad, Hercules, USA ) as a molecular marker runing from 50 to 2000 bp. The gel was examined in G-BOX ( Syngenes, Cambridge, UK ) under UV visible radiation. Recovery of E coli in the presence of an unreal nutrient environment Innoculum was prepared with pre-culture at the exponential stage when the concentration was 108cfu/ml. 100Aà µl was pipetted onto chromium steel steel vouchers incorporating different concentrations of unreal nutrient environment ( high, medium or low concentrations ) . After allocated clip ( 0 min, 30 min, 60 min ) vouchers were swabbed at 90à °angle. Swabs were cut into SETS ( Roche Applied Science ) and centrifuged for 10 min at 6000g. Pellet was re-suspended with 150Aà µl toller solution leting 50Aà µl for EMA intervention and 50Aà µl for home base numeration. Preparation of Propidium monoazide ( PMA ) PMA dissolved in 20 % DMSO to obtain a stock concentration of 20nM and stored at -20à °C off from the visible radiation. 1.25Aà µl PMA solution added to 500Aà µl of civilization aliquots to give a concluding concentration of 50nM following the incubation period of 5minutes in the dark with occasional commixture to let the PMA to perforate the dead cells and to adhere to the DNA. Samples are so put in ice and placed 20cm from 500W halogen visible radiation beginning for 15minutes. Samples centrifuged at 10,000g for 10 proceedingss. Samples washed with NaCl ( ) and MilliQ H2O ( ) in order to take the inactivated PMA. Bibliography. Angelotti R, Foter M.J, Busch K.A, Lewis K.H ( 1958 ) . A comparative rating of methods for finding the bacterial taint on surfaces Public Health Report 79 ( 11 ) pp 1021-1024 available: PubMed database [ accessed 10 March 2010 ] Astrographics ( 2002 ) Escherichia coli bacteria [ image online ] , available: hypertext transfer protocol: //www.astrographics.com/GalleryPrintsIndex/GP2144.html [ assessed 10 March ] Becker, B. , Weiss, C. , Holzapfel, W.H ( 2008 ) An rating of the usage of three phenotypic trial systems for biochemical designation of Enterobacteriacea and Pseudomonadacea Food Control 20 ( 9 ) available: Science Direct [ accessed 13 Feb 2010 ] Bej, A.K. , Steffan, R.J. , DiCesare, J. , Haff, L. , Atlas, R.M. , ( 1990 ) Detection of coliform bacteriums in H2O by polymerase concatenation reaction and cistron investigations. Applied Environment Microbiology 56 pp 307-314 Biomerieux Industry ( 2010 ) APIAà ®ID32E [ online ] available: hypertext transfer protocol: //www.biomerieux-industry.com/servlet/srt/bio/industry-microbiology/dynPage? open=NDY_IND_FDA_PRD A ; doc=NDY_FDA_PRD_G_PRD_NDY_17 A ; pubparams.sform=0 A ; lang=en [ accessed 19 March 2010 ] Bahrani- Mougeot F.K. , Paster, B.J. , Coleman, S. , Ashar, J. , Knost, S. , Sautter, R.L and Lockhart, P.B ( 2008 ) Designation of unwritten bacteriums in blood civilizations by conventional versus molecular methods Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology and Endodontology 105 ( 6 ) pp 720-724. Available: Science Direct [ accessed 11 March 2010 ] Copan Italia ( 2010 ) Why flocked swabs are superior to fibre cloaked swabs and froth swabs and how they can better infective disease nosologies , [ online ] , available: hypertext transfer protocol: //www.mls.be/nieuwsbrieven/css/Why-Flocked-Swabs-are-Superior-to-Fiber-and-Foam.pdf [ accessed 30 Feb 2010 ] Denton, M ( 2007 ) Enterobacteriaceae International Journal of Antimicrobial Agents 29 ( 3 ) available: Science Direct [ accessed 24 Feb 2010 ] Drudy D, O Rourke M, Murphy M, Mullane N.R, Kelly L, Fischer M, Sanjaq S, Wall P, OMahony M, Whyte P, Fanning S ( 2006 ) Characterisation of a aggregation of Enterbacter sakazakii isolates from environmental and nutrient beginnings International Journal of Food Microbiology 110 ( 2 ) pp 127-134 available: Science Direct database [ accessed 18 March 2010 ] Food Market Exchange ( 2001 ) HACCP Hazard Analysis Critical Control Point [ online ] available: hypertext transfer protocol: //www.foodmarketexchange.com/datacenter/laws/detail/dc_lr_reference_haccp [ accessed 17 Feb 2010 ] Galani I, Rekatsina P.D, Hatzaki D, Plachouras D, Souli M, Giamarellou H ( 2007 ) Evaluation of different research lab trials for the sensing of metalo-?-lactamase production in Enterobacteriaeae , Journal of Antimicrobial Chemotherapy 61 pp 548-553 Grant, M.A. , Weagent, S.D. , Feng, P ( 2001 ) Glutamate decarboxylase cistrons as a pre-screening marker for sensing of Escherichia coli groups Applied Environment Microbiology 67 pp 3110-3114 Griffith C.J, Davidson C.A, Peters, A.C and Fielding, L.M ( 1997 ) Towards a strategic cleansing assessment programme: hygiene monitoring and ATP luminometry, an options assessment Food Science Technology Today 11, pp 15-24. Hall L.B and Hartnett M.J ( 1964 ) Measurement of bacterial taint on surfaces in infirmaries Public Health Report 79 ( 11 ) pp 1021-1024, available: PubMed database [ accessed 24 March 2010 ] Horachova, K. , Mlejnkova, H. , Menjnek, P. , ( 2006 ) Direct sensing of bacterial fecal indexs in H2O samples utilizing PCR Water Science Technology 54 pp 135-140 Huang M.M, Arnheim N, Goodman M.F ( 1992 ) Extension of base mispairs byTaqDNApolymerase: deductions for individual nucleotide favoritism in PCR Nucleic Acids Research 20 ( 17 ) pp 4567-4573 Iqbal, S. , Robinson, J. , Deer, D. , Saunders, J.R. , Edwards, C. , Porter, J. , ( 1997 ) , Efficiency of the polymerase concatenation reaction elaboration of the uid cistron for sensing of Escherichia coli in contaminated H2O Lett Applied Microbiology 24 pp 498-502 Janda, J.M and Abbott, S.L ( 2001 ) Bacterial Designation for Publication: When is Enough, Enough? Journal of Clinical Microbiology 40 ( 6 ) pp 1887- 1891 Juck, D. , Ingram, J. , Prevost, M. , Coallier, J. , Greer, C ( 1996 ) Nested PCR protocol for the rapid sensing of Escherichia coli in drinkable H2O , Canadian Journal of Microbiology 42 862-866 Kang D, Eifert J.D, Williams R.C ( 2007 ) Evaluation of Quantitative Recovery Methods of Listeria monocytogenes Applied to Stainless Steel Journal of AOAC International 90 ( 3 ) Kenyon College ( 2010 ) , PCR sum-up of technique [ image online ] , available: hypertext transfer protocol: //biology.kenyon.edu/courses/biol114/Chap08/Chapter_08a.html [ accessed 20 March 2010 ] Kenyon College ( 2010 ) PCR sum-up of technique [ image online ] , available: hypertext transfer protocol: //biology.kenyon.edu/courses/biol114/Chap08/Chapter_08a.html [ accessed 20 March 2010 ] Khan, I.U.H. , Gannon, V. , Kent, R. , Koning, W. , Lapen, D.R. , Miller, J. , Neumann, N. , Phillips, R. , Robertson, W. , Topp, E. , Bochove, E. , Edge, T.A ( 2007 ) Development of rapid quantitative PCR check for direct sensing and quantification of culturable and non- culturable Escherichia coli from agiculture water partings Journal of Microbial Methods 67 pp 480-488 available: Science Direct [ assessed 13 March 2010 ] Kubista, M. , Andrade, J.M. , Bengtsson, M. , Forootan, A. , Jonak, J. , Lind, K. , Sindelka, R. , Sjoback, R. , Sjogreen, B. , Strombom, L. , Stahlerg, A. , Zoric, N. , ( 2006 ) The existent clip polymerase concatenation reaction Molecular Aspects of Medicine 27 pp95-125 available: Science Direct [ accessed 11 March 2010 ] .REVIEW Louie, M. , Louie, L and Simor, A. , E. ( 2000 ) . The function of DNA elaboration engineering in the diagnosing of infective diseases Canadian Medical Association Journal 163 ( 3 ) , pp 301-305 Mc Pherson, M. J. , Hames B. D, and Taylor, G. , R. , ( 1995 ) , PCR 2: A Practical Approach Oxford University Press, New York Microbiological hazard appraisal series 10 ( 2006 ) Enterobacter sakazakii and Salmonella in powdery baby expression, Google Books [ online ] , available: hypertext transfer protocol: //books.google.com/books? id=iHZSx2Wfe7EC A ; pg=PA76 A ; dq=enterobacteriaceae+in+food A ; as_brr=1 A ; cd=1 # v=onepage A ; q=enterobacteriaceae % 20in % 20food A ; f=false [ assessed 9 March 2010 ] Mossel D.A, Stryijk C.B ( 1995 ) Escherichia coli, other Enterobacteriaceae and extra indexs as markers of microbiologic quality of nutrient: advantages and disadvantages , Microbiologica 11 ( 1 ) pp 75-90. Available: Medline [ accessed 24 Feb 2010 ] Moore and Griffith ( 2002 ) Factors act uponing recovery of micro-organisms from surfaces by the usage of traditional hygiene swobing , Dairy, Food and Environmental Sanitation 22 ( 6 ) pp 410-421 Mueller, S.A. , Anderson, J.E and Byung, K ( 2009 ) Comparison of Plate counts, Petrifilm, Dipslides and Adenosine Triphosphate Bioluminescence for supervising bacteriums in chilling H2O armored combat vehicles , Water Environmental Research 81 ( 4 ) available: Wilson web [ accessed 24 March 2010 ] Nygren, J. , Svanvik, N. , Kubista, M. , ( 1998 ) The interaction between the fluorescent dye thiazole orange and DNA Biopolymers 46 pp 39-51 Ortega, M.P. , Hagiwara, T. , Watanabe, H. , Sakiyama, T. ( 2009 ) Adhesion behavior and removability of Escherichia coli on chromium steel steel surface Food Control 21 ( 4 ) pp 573-578 available: Science Direct [ accessed 13 March 2010 ] Reilly W.J. , Forbes, G.I. , Sharp, J.C.M. , Oboegbulem, S.I. , Collier, P.W and Paterson, G.M ( 1988 ) Poultry- Borne Salmonellosis in Scotland , Epidermiology and Infection 101 ( 1 ) pp 115-122 Rose, R.E. , Geldreich, E and Litsky, W ( 1974 ) Improved membrane filter method for fecal coliform analysis , Applied Microbiology 70 ( 9 ) pp 5692 5694. Roche PCR Applications Manual ( 2006 ) 3rd ed. , Germany: Fanz and Neumayer Rosrak D.B, Colwell R.R ( 1987 ) Survival schemes of bacteriums in the natural environment Microbial Rev 51 pp 365-379. Tsen, H.Y. , Lin, C.K. , Chi, W.R. , ( 1998 ) Development and usage of 16S rRNA cistron targeted PCR primers for the designation of Escherichia coli cells in H2O Journal of Applied Microbiology 85 pp 554- 560 Van Acker, J. , De Smet, I. , Muyldermans, G. , Bougatef, A. , Naessens, A. , Lauwer, S. ( 2000 ) Outbreak of Necrotizing Enterocolitis Associated with Enterobacter sakazakii in Powered Milk Formula , Journal of Clinical Microbiology 39 ( 1 ) pp 293-297 Wook Oh, S and Kang, D.H ( 2004 ) , Fluorogenic selective and differential medium for isolation of Enterobacter sakazakii , Applied and Environmental Microbiology, 70 ( 9 ) pp 5692-5694. Yang I, Kim Y H, Byun J.Y, Park S.R ( 2005 ) Use of manifold polymerase concatenation reactions to bespeak the truth of theannealing temperature of thermic cycling Analytic Biochemistry 338 ( 2 ) available: Science Direct [ assessed 10 March 2010 ]
Wednesday, February 19, 2020
Child Protective Services Essay Example | Topics and Well Written Essays - 1000 words
Child Protective Services - Essay Example Arguments from both sides will then help the audience reach a conclusion on their own. Running through a brief history of CPS, 1655 was the first time a criminal case was brought up against child abuse in the courts of what is now the United States of America. In 1825, states made laws etched in their law books to protect the rights of children and granting the authority to several agencies to remove children from the custody of parents and guardians who deemed unfit to perform the parental role (Thomas, 295). By 1974, 49 U.S States had passed the law, hence the federal government moved quickly to pass the federal ââ¬Å"Child Abuse Prevention and Treatment Actâ⬠(CAPTA) (Pecora et al, 232). This act was actually the last calling to establish the CPS which started functioning with proper rules and policies by the end of 1974. Thesis CPS is an essential part of the current society in the modern world; it should be made a strong agency with the proper backing of law enforcement ag encies so it is a reckoning force against those who tackle with the future of our young generation. A lot of voices have been raised against the CPS and its services but every establishment has its flaws, so does the CPS. As the number of cases reported in a year on a rise each year, more efforts have to be made for securing the future of our country. Arguments are that the program should be downsized because of its inability to do its job efficiently. However, the actual requirement now lies with the government to properly fund the program so no child goes unattended because the workers are not being able to attend to every child abuse report being filed with them. Support A variety of important people in the social service circles have been calling out for reforms or betterment for the system in place. Some even dare to propose the calling off of the CPS as they believe that it is not meeting the desired goals, across the nation. Abuse and neglect in children is still prevalent; t he system has loopholes through which parents and foster care givers are benefitting, covering their deeds by the noble act of performing their responsibility, key word being ââ¬Ëactââ¬â¢. Every coin has two faces; both are different, almost opposites. American sentiment toward residential placement for troubled youths is increasingly suspicious, pessimistic, and even hostile. Yet many families are too dysfunctional to warrant keeping their youth at home and alternatives are scarce. Foster families are simply unavailable for many of the estimated 840,000 children who will require out-of-home placement by 1995. The most empirically supported criticism of residential placement is its limited positive influence on post placement problems such as delinquency (Pecora et al., 1992). Children are living on the roads because their parents are too poor or too intoxicated to even know their own identity, let alone take care of their children. Also the issue of child abuse is one which w ill have calamitous effect on the future generations. The only hope for the distressed children is the CPS. They take the children under their umbrella and place them with willing and caring families; families, who have taken up the added responsibility on their shoulders to provide care and affection to the children who did not have the same environment to grow in. It is a dangerous world for un-protected children out there;
Tuesday, February 4, 2020
Laptops in Lectures Essay Example | Topics and Well Written Essays - 750 words
Laptops in Lectures - Essay Example According to Fields, laptops use during lectures is the biggest distraction to listening of a student during lectures. This is because, when using the machine, so many catchy items may come along as in the internet, there is usually breaking news on celebrities which is an area of interest to most of the students in class. Fields further believes most of the addictives come with the use of internet which causes very big distractions like playing new games (Fields 1). I would like to disagree with this idea, as the use of computers in lectures can be used to establish the rate and level of attentiveness of a student while in class. Most of the students that are allowed to use these machines at lectures have the highest rate of concentration level. This is attributed to the fact that most of these students have to pay attention to any idea that a lecturer puts across and record it as well. This means that laptops increase the level of concentration and also allows the students to multi task.Ã According to Fields, there is heavy reliance on the internet for any source of information currently. Most of the students allowed to use laptops during lectures tend to rely on the internet for any new information which does not allow the students to use their brains to think even the most basics ideas. Most students have become so reliant on this technological gadget and even the most reliable sources of information that is found in books are currently not being paid attention to.Ã
Monday, January 27, 2020
World Leaders And Their Leadership Styles History Essay
World Leaders And Their Leadership Styles History Essay Adolf Hitler is recognized worldwide for his leadership in the Nazi Party and also as the chancellor of Germany during the early period of 1930s. His leadership style was autocratic leadership as he believed in acting like a dictator and focused on making decisions on his own. He never trusted his generals and felt no need of having two-way communication as he wanted to have complete legitimate power in everything. Hitler believed that the ultimate authority resides with him and it should never be extended downward. He made decisions that were supportive in enhancing his legitimate power. Any mistake made by the followers was unacceptable and punishments were given for wrong doings (Megargee, 14). Since Hitler was reluctant to take advice from anyone and made all decisions on his own, his followers did not like this attitude and started developing ill-feelings towards him. From the analysis of Adolf Hitlers leadership style, the leaders of the todays world have realized that they cannot be a dictator and cannot get the work done by forcing their followers (Popper, 64). The modern leaders and managers in organizations have ensured that they implement collaborative methods so that the followers and subordinates are part of the team and the joint efforts will ultimately produce positive results. The leaders who have adopted this style of leadership have faced strong resistance from their followers and even received less support from them in accomplishing the ideal objectives. Mahatma Gandhi is among the favorite personality of most of the leaders worldwide and majority of them want to follow the leadership style followed by such an inspirational man (Barnabas and Paul, 135). Mahatma Gandhi had a servant style of leadership which is described as the style in which a leader takes care of his followers even before they start taking care of themselves on their own. This inspirational leader emphasized that the struggle should be done in non-violent manners without using any harmful weapons; the leader had to face severe problems such as beating by the British police and getting locked up in the prison when he started fighting with British for independence of India. Gandhi had a clear vision about the independence of Hindus and was able to communicate this vision effectively to dispersed people by using simple and inspiring language. One aspect that was stressed by the leader was never to accept defeat and keep on striving hard because success will eventually; the moral is that people should never lose hope and continue the efforts until the goal is attained (Nojeim, 30). His personality is a source of inspiration for the leaders and managers of todays world that no matter how challenging the situation gets it is important to boost the morale of oneself and the followers. As a leader, the person should motivate his/her subordinates until the victory is gained in the particular mission. Abraham Lincoln Abraham Lincoln had the desire of serving his country so that he could bring revolutionary changes that will be beneficial for its people in the long-run. Abraham Lincoln had a servant leadership style; one of the vital components of this form of leadership is the importance of ethical values i.e. working for the benefits of the people and this aspect was evident in the leadership style of Lincoln (Hubbard, 21). The servant leader wants to lead the people because he/she has internal desire of serving the people; the person does not need any legitimate power to bring the changes. Abraham Lincoln focused on the sustainability element which meant producing a lasting change that will finally lead to the transformation of others. The leader was provided the opportunity of demonstrating his leadership traits during the American Civil War; he had two lasting impacts on the world i.e. freeing the slaves and preservation of the Union (Polelle, 40). During his Presidency, Lincoln followed a prudent and careful leadership to bring about mandatory reforms in the United States of America. The leader also set the example of the paramount democracy in the world and even extended the liberty opportunity to every American. In present times, Americans have been given the full liberty of expressing their feelings and fighting for their rights and it has revolutionized the way in which democracy should be implemented by the leaders so that projected results are successfully accomplished. Even in organizations, the work culture has been changed i.e. employees are motivated to share their ideas and claim their rights as the organization is compelled to fulfill all the requirements of its workforce. Alexander the Great At the age of twenty, Alexander became the king and in eleven years of his journey he fought more that seventy battles and never lost any one of them. The leadership style of Alexander the Great is visionary leadership as he shared the vision with his people to motivate them to inspire them in achieving the well-set goals (Polelle, 23). From the analysis of the leadership traits of Alexander the Great, it is evident that he had set certain set of principles to inspire his followers such as show people that they are considered to be valuable and are given importance in every decision by seeking their opinions, lead by example so that people are inspired to follow the leader, innovation should be encouraged so that something new can be done and every action should be taken after creating a vision so that there is clarity about the goal that will be achieved (Cartledge, 14). In todays world, the leaders have realized that they need to first follow what they tell their followers so that the leaders can gain their trust. When any decision is made, it should be done on a consensus manner so that everyone agrees to it and they can see the big picture clearly. A visionary leader communicates to his followers the effectiveness of the entire process and their importance in this process so that their production level gets accelerated. Julius Ceasar Julius Ceasar was an exceptional general and one of the important leaders in ancient Rome. In his life, he held almost every vital title in the Roman Republic such as tribune of the Roman people, consul, well-known priest and high positioned commander of the army (Freeman, 32). He dared to introduce new laws that were easily approved by the Senate and he is recognized globally for improving the ways in which the provinces were governed and he even developed his own army. After conquering the Rome, he became the master and started ruling the place like a dictator. Caesar used his power for carrying out the needed reforms, relieving huge amount of debt, revised the calendar and enlarged the Senate. He was assassinated by his enemies in 44 B.C. (Popper, 70). It shows that a dictator has less chances of gaining appreciation by the followers as all other leaders who have followed the dictatorship style of leadership have never been able to get the support of their people and have faced unfortunate deaths in the form of assassination. Hence, the dictatorship leadership is not acceptable by people as the leaders tend to focus on their own benefits rather than on the followers needs. Napolean Napolean was among the best conquerors of the world and his efforts are recognized globally. During the French Revolution period, the leader took various important decisions that proved to be harmful for his followers (Blaufarb, 42). Although the positive aspects of his personality were that he had a clear vision about his goal, had the ability of motivating the people to achieve the desired goals and ensured that he took proper care of his people. However, his followers believed that the leader made decisions that were beneficial for himself and cared less for them. Napolean has received a lot of criticism for being a dictator as many wrong decisions were taken by him that severely impacted the lives of people. Since he was an ambitious person, he started making decisions without taking consent of his followers and started giving commands to his army (Polelle, 62). When he got carried away in the lust of power, he had to face defeat by the Russian Army on his way back to Austria; it shows that the dictators or autocratic style of leadership is among the least preferred styles of the leader. When a leader becomes a dictator, his/her relationship with the followers starts to get deteriorated and eventually it breaks. Napoleon is still considered to be the best conqueror in the world as he had the highly exceptional intellectual capabilities. Genghis Khan Genghis Khan was among the noteworthy leaders of Mongolia who conquered most of the Asian and European areas; his style of leadership is classified as a combination of autocratic leadership and participative leadership. Genghis Khan was considered a dictator because whenever he conquered any of the regions he would give only two options i.e. either surrender or get killed. However, when working with his army, he used to take their opinion and share his ideas with them so that they can develop a strategy for the implementation of the plan successfully (Ratchnevsky, 26). Genghis Khan moved to the loyalty to himself and he even started to deal with his adversaries in an inappropriate manner. Anyone who opposed to his conquest and power had to suffer from an extreme blow. Since Genghis Khan started treating people in a brutal way, he was assassinated later by his enemies (Man, 51). It has become important for todays leaders to realize that they can be successful only when they have cordial relations with their followers and they try to incorporate their demands so that a healthy relationship is created which will last for a long period. The autocratic leaders will face strong resistance from their followers so it is advisable to use it to minimal extent to ensure control within the organization or legal body but it should not be followed excessively as it will create problems such as retaliation from subordinates in the long-run. George Washington George Washington had a servant leadership style as he had the vision of revolutionizing everything in US during his presidency. He knew that he can motivate the people only by developing an inspirational personality and he did extensive efforts for creating the desired image. He even motivated his people to provide him support in attainment of the goals so that the set vision can be accomplished (Northouse, 72). The main characteristics of his personality as a leader were that he was willing to accept any challenge and face it; he was persistent in achieving the set targets; and was brave enough to handle all the issues and provided help to his people in resolving them. Since he had no lust for power and wanted to work for the benefits of his people, he always ensured that the decisions made by him were in accordance with the requirements of the country. As he was a trustworthy president, people started showing their loyalty to him and provided their complete assistance so that they could successfully implement any necessary change in the country effectively (Bongilla, 35). The leaders who want to gain the support of their followers have to develop their personality that has certain key traits such as confidence, integrity, courage, self-discipline and clear vision. George Washington is the best example for all those leaders who want to do something beneficial for the country and get the support of its people. Franklin D. Roosevelt Franklin D. Roosevelt is recognized for helping U.S. to get out of the Great Depression period in 1930s by helping the people in rebuilding their self-confidence. His leadership style is a combination of charismatic leadership and transformational leadership as he inspired the people to get back on their feet and initiate the activities to help the country get out of the dark times. Roosevelt provided his people various avenues to do a lot of creative thinking but with a focused approach; he first set out the vision so that everyone was aware of the final goal that has to be attained (Greenstein, 45). The best lesson learnt from the leadership of Franklin D. Roosevelt is that fear is something that needs to be conquered and there is nothing to fear about. The leaders can take inspiration from such an extraordinary leader who taught people how to maintain their focus on specific vision and face the challenges with courage and bravery. It is mandatory for every leader to accept the challenge of life and work and be prepared to handle them with confidence and will power to counter the challenge. Since the changes happen at a fast pace these days, the leaders have to remain alert all the time for the problems that can arise and they should react to them in a calm and an organized way. Winston Churchill Winston Churchill leadership style is classified as transformational and charismatic leadership; he was among those leaders who always kept the people motivated by delivering inspirational speeches. During the World War II, Winston Churchill provided immense support and guidance to the Great Britain by developing strength and courage among the people (Nordquist, 2). As a leader, he focused on three important aspects for developing a charismatic personality that comprised of elements such as excellent communication skills, creating a vision so that everyone is able to keep a focus on single goal and developing trust so that people are willing to provide their support to the leaders. From the leadership style of Winston Churchill, it is evident that the leaders have to develop a charismatic leadership by strengthening the bond with their followers so that everyone is part of the team (Axelord, 34). When the entire team shares a common vision, only then conflicts, problems and issues can be resolved. As most of the organizations have to undergo changes, they will face resistance from the people; communication is the key to resolving this issue by sharing with them the purpose of the change along with showing them the vision. Hence, excellent communication and well-designed vision can inspire people to work hard and support their leaders in achieving the desired goals. Conclusion The world leaders have demonstrated different leaderships and they have been successful in accomplishing various challenging tasks. Regardless of the dictatorship style, some of the common features that are important for the leaders and organization in todays world are creating a vision so that everyone has an idea about the goal that will be achieved in the long-run, motivating people to make valuable contributions and developing excellent communication skills so that a clear, concise and right message can be communicated to everyone. Therefore, the leaders and managers have to realize that they can achieve their objectives by getting support from their followers and subordinates and showing them appreciation for making valuable additions by offering them excellent rewards. The leaders have to develop a charismatic personality so that they can inspire their followers and should lead by example so that positive results can be attained.
Subscribe to:
Posts (Atom)