APA Critical Analysis Essays - Educational Psychology,

APA Critical Analysis: Teaching Students How to Learn Vol. 31, No. 6, June 2000 In "Teaching Students How to Learn" it showed the correlation between high-achieving students and their self monitoring in classes. The article goes on to say that unlike high school, college students do not have the regulation in their classes. A lot of the students do not know how to learn and set goals for themselves. Those students who highly monitor themselves tend to also have higher academic success. The article goes on to suggest that professors teach the students how to learn for themselves and set goals. Professors say that with the amount they must already teach there is not enough time to through in this new material. It is beneficial for college students to learn to learn, but many students lack the motivation behind this. A major problem with the study is looking at the motivation of the students. Many students are in college just for the good times, and not looking at the educational aspects. It should not be on the professors shoulders to baby-sit their students. A separate class could be offered on learning to learn for students wishing to take it whom are wanting to become higher achievers.

Food safety management systems Essays

Food safety management systems Essays Food safety management systems Essay Food safety management systems Essay 1.1 Enterobacteriaceae An increased consciousness and a better apprehension of the nutrient industry and its associated hazards with microbiological taints have been the consequence of the broad usage of nutrient safety direction systems in Ireland. Hazard Analysis Critical Control Point ( HACCP ) is the chief nutrient safety system used throughout nutrient industries. Although this system was introduced in the 1960 s it was merely in 1998 that the EU Hygiene of foodstuffs Regulations implemented this referential in all nutrient concerns in Europe ( Food Market Exchange 2001 ) . Microbiological controls are performed to guarantee the quality and safety of the nutrient merchandises. The patterned advance in scientific discipline and microbic engineering hold given a better apprehension of nutrient production, processing and saving and the nexus between the microscopic and macroscopic universe. This relation enables micro-organisms to be exhaustively examined and evaluated. Food borne unwellnesss are the mos t widespread public wellness jobs, making societal and economic loads along with human enduring. In order to seek cut downing the hazard of such unwellnesss and nutrient poisonings, hygiene steps are required in nutrient processing environments ( Microbiological hazard appraisal 2006 ) . The presence of Enterobacteriaceae in nutrient or food-contact surfaces in such environments serves as hygiene indexs. : Enterobacteriaceae are a big household of bacteriums that comprise of at least 34 genera, 149 species and 21 races. Cells are typically 0.3-1.8AÂ µm in length. ( Blackburn day of the month? ) They are rod shaped, Gram negative facultative anaerobes and are natural dwellers of bowels in both worlds and animate beings. They are found extensively throughout the dirt, H2O, on fruit, veggies and cereals. They play a considerable function in human wellness as many pathogens fall under this household which are known to do many infective diseases. Harmonizing to Kang et Al ( 2007 ) a minute sum of 10 settlement organizing units ( CFU s ) of peculiar micro-organisms can take to life endangering infections particularly in the immune-compromised. Salmonella typhimurium is responsible for typhoid disease while Escherichia coli is a common cause of stomach flu. ( Becker et al 2008 ) . Other Enterobacteriaceae associated diseases include infirmary acquired pneumonia, blood stream infections such as bacteraemia and blood poisoning, urinary piece of land infections and intra abdominal infections ( Denton 2007 ) . Enterobacteriaceae have been preponderantly associated with nutrient pathogen eruption. As discussed by Reilly et Al ( 1988 ) 224 eruptions of salmonellosis associated with domestic fowl meat were reported in Scotland entirely between 1980 and 1985. Among the 2245 people infected 12 died. Salmonella typhimurium and Salmonella enteritis were the chief serotypes associated with the eruption. In recent old ages the serotype Enterobacter sakazakii now known as Cronobacter sakazakii been identified as an emerging pathogen. It has been found in infant milk expression and has been the cause of neonatal meningitis and sepsis. It targets immune-compromised babies and those with a low birth weight. ( Van Acker et al 2000 ) In the 1920 s coli-aerogenes ( coliform ) group was indispensable as an index in the proof of equal processing processs in the dairy industry i.e. Pasteurization of dairy merchandises. It is apparent that since the 1950 s the full Enterobacteriaceae household has been preferred over other taxons as marker beings as they are known to be better defined when it comes to their finding and the household includes more beings of significance than other households. In the 1980 s Escherichia coli was foremost used as a mention being in the monitoring of imbibing H2O supplies. ( Mossel and Stryijk 1995 ) A microbic index harmonizing to Moore and Griffith ( 2000 ) is a microorganism that is an index for the possible presence of pathogens. 1.2 Adherence of Enterobacteriaceae to surfaces. The adhesion of micro-organisms to surfaces in the nutrient industry chiefly on treating equipment is one of the major concerns in the equal control of quality and safety of nutrient merchandises. If cleansing and sanitation are deficient, micro-organisms on the surface can last by the development of a biofilm. ( Ortega et al 2009 ) . A biofilm reduces susceptibleness to disinfectant and increases polysaccharide production. The happening of a biofilm can take to post processing taint taking to a lowered shelf life of a merchandise and the transmittal of diseases. In add-on it has been known to do mechanical obstruction, damage of heat transportation, addition in unstable frictional opposition and the corrosion of metal. ( Fuster-Valls et al 2007 ) To day of the month no ideal method for finding the cleanliness of surfaces has been available. The combination of ocular, non microbial and microbiological methods can take to an integrated cleansing monitoring scheme. ( Griffith et al 1997 ) . The ability to quantify micro-organisms on nutrient contact surfaces provides indispensable information for patterning consumer exposure from cross taint in the nutrient industry through nutrient production, nutrient conveyance and in nutrient service environments. Many infective bacteriums have been known to adhere to surfaces particularly unstained steel, glass and gum elastic. Stainless steel is used extensively throughout the nutrient processing and the nutrient conveyance industry. As described by Ortega et Al ( 2009 ) , unstained steel is most widely employed due to its mechanical strength, corrosion opposition and easiness of fiction . Despite looking smooth to the unaided oculus, when chromium steel steel is viewed under the microsco pe it is shown to be really unsmooth with many distinguishable defects. These defects are thought to harbor bacterial cells which with the add-on of H2O and foods would heighten the micro-organism s endurance ( Moore and Griffith 2002 ) . There have been limited surveies on the adhesion behavior on Escherichia coli on chromium steel steel. Ortega et Al ( 2009 ) stated 108cfu/ml of civilization on chromium steel steel for 2 H at 20Â °C was under the sensing bound. In contrast another survey suggested 105cfu/cm2 were found on chromium steel steel after vouchers were inoculated with 108cfu/ml at 4 Â °C for 24 H. 1.3 Sampling of surfaces with swabs and sponges. Harmonizing to Hall and Hartnett ( 1964 ) , a simple convenient sample process would be utile to trace path of infection , for the identification of human bearers, rating of decontamination processs and bacteriological surveillance of the environment which could hence take to in-service preparation of forces concerned with sanitation . Surface sampling is going progressively of import and legion probes have been afoot to happen a simple, dependable, bacteriological trial to find, quantitatively, the healthful quality of environmental, nutrient and hand-contact surfaces. ( Angelotti et al 1958 ) . Cleaning agendas in the nutrient industry are designed chiefly to cut down both nutrient dust and to decrease microorganisms to degrees that pose small or low hazard to both safety and the quality of the merchandise. ( Moore and Griffith 2002 ) Traditional swabs are made from a wooden or plastic shaft with cotton, rayon, Dacron, or alginate fibers which are spun organizing a bud at one terminal. Moore and Griffith ( 2007 ) discourse how the wetting agents applied to swabs have dramatic effects on the sum of bacteriums recovered from a surface. The chief points to be assessed in finding how effectual peculiar swab types are depend on the remotion of bacterial contaminations from a surface, the release of these bacteriums from the swab bud and the subsequent cultivation . It was found that cotton swabs absorbed more liquid than other swabs evaluated. When bacteriums were recovered from wet surfaces it was apparent that coppice textured, Rayon and Dacron tipped swabs removed a significantly fewer CFU s compared to the cotton swabs. It was shown how cotton swabs performed every bit every bit good when trying a dry surface. Moore and Griffith ( 2007 ) province that cotton swabs consist of a secondary wall that is made up of cellulose. This enables the cotton to swell when positioned in wetness to ensue in an increased soaking up of liquid together with bacteriums entrapped indoors. These positive features that enable cotton swabs to take high degrees of bacteriums from a surface are thought to impede the swabs release of the bacterium. It can be predicted that the usage of a swab with a hapless initial absorbency could later ensue in a higher overall bacterial recovery with the assistance of dilutants to ease bacterial release. Moore and Griffith ( 2007 ) besides discuss how it was apparent upon go forthing the swabs at room temperature for 24 H that the release of bacteriums from the cotton swab was greater than other swabs. It was apparent that the bacterium became entrapped within the cotton fibres hence protecting the bacterium and assisting to make a microenvironment enabling the bacterium to last. In contrast to Moore and Griffith ( 2007 ) statements, Copan Italia ( 2010 ) shows how unfastened cell froth swabs have good release of the bacteriums but demonstrated soaking up of 3-5 times less than in traditional fiber swabs due to their construction ( Figure 1 ) . The development of Flocked swabs which have good releasing belongingss and can absorb five times more than cell froth swabs are widely used in clinical nosologies but have nt been applied yet to the recovery of Enterobacteriaceae throughout the nutrient industry. 1.4 Biochemical trials for the sensing and quantification of Enterobacteriaceae and their restrictions. Current biochemical and civilization based checks tend to be cheap and comparatively simple nevertheless there are restrictions with such trials. One of the chief restrictions includes the length of clip that is needed for the sensing and numbering of bacteriums. False- positive consequences, the loss of viability of bacteriums from aggregation to its numbering and the deficiency of growing of feasible yet non cultural bacteriums have been associated with current biochemical and civilization based checks. ( Rosrak and Colwell 1987 ) Today the Gram discoloration process is of common usage in research labs as the first method of designation for a micro-organism. The method was originally published in 1883 by Hans Christian Gram. This technique nevertheless is nt ever demonstrative of true Gram nature. Some Gram positive bacteriums may stain Gram negative due to cell wall harm in the bacteriums by over exposure to O. ( Bahrani Mougeot et al 2008 ) Blackburn ( day of the month? ) stated that the proving for enteral pathogens such as Salmonella requires specific methods that are labour intensive and can take several yearss to finish. Furthermore, infective bacteriums in nutrient are frequently non homogeneously distributed and are present in low Numberss doing sensing hard. Many nutrient production sites chiefly prefer to prove for enteral pathogens in external research labs while the testing of E.coli and Enterobacteriaceae are routinely tested to supply convenient appraisal of possible fecal taint. Many methods published from International Organisation for Standardisation ( ISO ) methods are available, where many processs of sensing are quantitative. The bulk of nutrient makers impose acceptable bounds for a given micro-organism. The Most Probable Number ( MPN ) technique from ISO 4831:2006 ( ISO 2010 ) and plating utilizing pour or spread technique are chiefly used. Violet Red Bile Glucose Agar ( VRBGA ) and Violet Red Bile Agar ( VRBA ) incorporating lactose have been deemed the most popular media for analyzing nutrients for Enterobacteriaceae. Their sensing and numbering are based chiefly on their ability to bring forth acid and gas from the agitation of glucose and milk sugar which is detected by the pH index impersonal ruddy. An sheathing is recommended to guarantee agitation of the saccharides and to cut down the hazard of oxidization every bit good as bettering the specificity of these media and later cut downing intervention from background vegetations or motile strains ( Blackburn day of the month? ) . There has been grounds that non Enterobacteriaceae bacteriums can turn on VRBA and VRBGA hence proposing that this method can impede specificity. The growing of Aeromonas spp has been detected on VRBGA harmonizing to Petzel and Hartman ( 1985 ) and VRBGA has been seen to be insufficiently selective bespeaking 52.4 % of consequences obtaine d to be false- positive ( Wook Oh and Kang 2004 ) MPN methods can supply greater sensitiveness compared with plating techniques when the taint degrees are low. However if the concentration of taint is high the consequences show greater fluctuation and may take to false positive consequences. MPN technique consists of multiple tubings of different media including Buffer Peptone H2O, Enterobacteriaceae enrichment stock. ( See figure 2 ) Enterobacteriaceae are oxidase negative and this trial is used to prove for the presence of the enzyme cytochrome oxidase to corroborate presumptive settlements in correlativity with glucose agar trial which tests for agitation of glucose. If agitation occurs it consequences in abundant production of acerb terminal merchandises ensuing in a color alteration. This method required by ISO described by Rose et Al ( 1974 ) has low preciseness and inordinate clip is necessary for analysis runing from 5-7 yearss. APIa„? designation systems from Biomerieux are used widely throughout research labs. ID32E, is a standardized system in which the designation of Enterobacteriaceae and other not fastidious Gram negative bacteriums can be quickly identified. Many surveies have been reported utilizing API as method of designation including those of Drudy et Al ( 2006 ) and Galani et Al ( 2007 ) . The API/ID32E sensing kit is the most extended of the scope of API merchandises available. It includes 15 designation systems covering all groups of bacteriums encountered in industrial microbiological research labs ( BioMerieux, 2010 ) . The dependability of APIa„? designation systems it used throughout industries. Janda et Al ( 2001 ) stated nevertheless that the trials included in the API 20E strip in 1975 were still the same in 2001 even if the Numberss of taxons in the Enterobacteriaceae household has increased well between those old ages. The ready to utilize Petrifilm system has been released by 3M health care for the sensing of foodborne pathogens. It s easy to utilize technique comprises a selective media under a transparent movie ( 3M health care ) . The media is hydrated by the add-on of bacterial suspension and after incubation seeable settlements can be counted. ( Blackburn? ? ) Despite this method being speedy and convenient, Petrifilm systems are expensive. Restrictions of this technique discussed by Mueller et Al ( 2009 ) show that some settlements shown on Petrifilm are excessively little to see from bare oculus. Therefore the usage of magnification for accurate visual image is required. It was shown that some beings can liquefy the gel on the movie leting spreading of growing and subsequent harm to other bing settlements supplying a lower count of settlements. Standard methods such as conventional civilization and biochemical based checks used to recite necessitate 18-24 H for consequences to be obtained. Progresss in modern molecular biological science have seen the development of molecular checks such as the polymerase concatenation reaction ( PCR ) that have become highly dependable and important in the sensing of bacterial species ( Khan et al 2007 ) . 1.5 Alternate DNA- based method for the sensing and quantification of Enterobacteriaceae 1.51 DNA extraction The rules of DNA extraction as discussed by Jordan ( 2008 ) include the debasement of microbic cell wall to let go of the Deoxyribonucleic acid and to sufficiently take sample constituents which can cut down assay efficiency and degrade the Deoxyribonucleic acid. Due to the complexness of nutrients matrices there are many inhibitors of DNA extraction including saccharides, fats, proteins, metal ions, phenoplasts and cell dust. 1.52 Polymerase Chain Reaction Polymerase Chain Reaction ( PCR ) is one of the most widely used molecular biological science techniques in the research lab. This is due to its specificity, flexibleness, singular velocity and its resiliency ( Mc Pherson et Al 1995 ) . PCR was developed in the 1980 s and the technique has been continuously improved and modified to spread out its versatility and pertinence . This Deoxyribonucleic acid based method has become an indispensable and day-to-day performed experimental technique in many research Fieldss and clinical research labs to observe infective agents, to magnify familial stuffs from limited volumes of DNA sample ( AÂ µl ) and for cloning for sensing of familial look degrees. ( Yang et al 2005 ) . PCR is utile for both the diagnosing and direction of a assortment of infective diseases. ( Louis et al. , 2000 ) PCR Mix: PCR mix is made up of DNA polymerase, a forward and a contrary primer, bases, a DNA Target and PCR buffer with MgCl2. PCR stairss PCR elaboration can turn a few molecules of a specific mark nucleic acid into a mcg of DNA. Roche PCR Applications Manual ( 2006 ) explained how the procedure of PCR occurs in three chief stairss of 1 ) Denaturation, 2 ) Annealing and 3 ) Extension with the usage of temperature cycling ( figure 3 ) . Denaturation occurs at 90Â °C when heat separates double stranded DNA into two individual strands. Since the H bonds associating the bases to one another are weak they break at such high temperatures, whereas the bonds between the deoxyribose and phosphates which are strong covalent bonds remain integral. The end of PCR procedure is non to retroflex the full strand of Deoxyribonucleic acid but to retroflex a mark sequence of about 100-35,000 base brace that is alone to the being. Primers are used to specify the terminals of that sequence. Primers are short, man-made sequences of single- stranded DNA typically dwelling of 20-30 bases. The annealing measure takes topographic point between 40Â °C to 65Â °C depending on the length on the length and sequence of the primers. This allows the primers to temper specifically to the mark sequence. Once the primers anneal to the complementary DNA sequences, the temperature is raised to about 72Â °C and DNA polymerase begins to synthesise new dual stranded Deoxyribonucleic acid molecules that are indistinguishable to the original mark DNA. It does this by easing the binding and connection of complementary bases that are free in solution ( dNTPs ) . Synthesis ever begins at the 3 terminal of the primer and returns entirely in the 5 to 3 way. The new synthesis efficaciously extends the primers, making a complementary two-base hit stranded molecule from a single-stranded templet. After the PCR procedure is complete, cataphoresis must be completed in order to For the sensing of bacteriums within nutrients the mechanism of PCR has proved to be really effectual. Low degrees of 3cells of Campylobacter were found in meat samples utilizing this technique ( Waage et al 1999 ) . However During PCR elaboration, short Deoxyribonucleic acid sequences are copied at each rhythm. Theoretically the sum of Deoxyribonucleic acid at each rhythm should duplicate at each rhythm, ensuing in an exponential elaboration of the initial mark DNA. Fraga et Al ( 2009 ) demo how this is potentially true during the early phases of the reaction when the constituents present in PCR are in huge extra compared to the mark sequence. As the merchandise accumulates, the substrates become low ensuing in suppression. In order to look at the efficiency of the reaction, PCR can be divided into three distinguishable stages: exponential, additive and tableland. The first stage is exponential stage in which the reaction is 100 % efficient with the doubling of merchandise at each rhythm. As the amplicon exponentially accumulates in measure the PCR constituents are used up and the primers begin to vie with the amplicon and the reaction efficiency later decreases. As the reaction slows down the additive stage begins. The merchandise formed in this stage is extremely variable due to the rate at which peculiar constituents are depleted and the accretion of merchandises. The tableland stage is when the reaction Michigans due to depletion of substrates and the suppression of merchandises. There is an highly big difference between the additive stage and the concluding sum of merchandise produced. In conventional PCR, sensing of PCR merchandise is completed late in the additive stage or at plateau stage. As seen in figure 5 there can be a distinguishable difference in the two stages demoing that conventional PCR is variable when it comes to quantitative consequences. 1.42 Real clip PCR The development of existent clip quantitative PCR ( QPCR ) presents more rapid, specific and quantitative numbering of peculiar mark cistrons as they are amplified in existent clip. In existent clip PCR the sum of merchandise formed is monitored during the class of the reaction by supervising the fluorescence of dyes or investigations introduced into the reaction that is relative to the sum of merchandise formed, and the figure of elaboration rhythms required to obtain a peculiar sum of DNA molecules is registered. ( Kubista et al 2006 ) . Real clip PCR checks are characterized by a broad scope of quantification of 7-8 logarithmic decennaries, high proficient sensitiveness, high preciseness and it does nt necessitate any station PCR steps hence the hazard of taint is reduced. ( Klein D 2002 ) Real clip PCR processs follow the same rules of conventional PCR in the readying of mixes and cycling of temperature. This rapid sensing method uses a sensing format, normally a fluorescent dye that binds to the PCR merchandise. The sum of fluorescence generated is relative to the sum of PCR merchandise formed. Initially the signal is weak and hence indistinguishable from the background but as the PCR merchandise accumulates, the fluorescence can be acquired by the existent clip PCR device. A threshold line is developed by the existent clip device and the CT value is determined. CT value is the figure of rhythms required to make fluorescent threshold. Real clip PCR generates a CT value for each DNA sample which is hence relative to the transcript figure DNA. Normally used fluorescent Reporters SYBR Green 1. Asymmetric cyanine dyes such as SYBR Green 1 have two aromatic systems incorporating N, one that is positively charged connected by a methine span. The dye has virtually no fluorescence when free in solution due to quivers prosecuting both aromatic systems, which convert electronic excitement energy into heat that dissipates to the environing dissolver. When the dyes bind with DNA they emit fluorescence. ( Nygren et al 1998 ) As disussed by LightCycler Rea clip PCR Systems ( 2009 ) , SYBR Green binds to all double stranded Deoxyribonucleic acid molecules irrespective of the sequence. When it comes into contact with dual stranded Deoxyribonucleic acid its fluorescence additions significantly. Harmonizing to Monis et Al ( 2005 ) SBYR Green 1 has a restriction in dye stableness and dye dependent PCR suppression and the selective sensing of amplicons during DNA runing curve analysis. HYBRIDISATION PROBES HYDROLYSIS PROBES TAQMAN PROBES LUX PRIMERS SYBR Green 1 is normally used in existent clip PCR. However, these asymmetric dyes nevertheless are considered sequence non-specific newsmans in real-time PCR. They tend to breathe fluorescence signal to all double stranded DNA even unwanted primer-dimer merchandises. Primer dimer merchandises interfere with the formation of specific merchandises due to competition of the two reagents and may take to wrong readings. Melting curve analysis can easy recognize primer-dimer formation. Temperature is increased and fluorescence is measured as a map of temperature. As temperature additions, fluorescence lessenings due to increased thermic gesture. When dual stranded DNA separates an disconnected bead in the fluorescent signal occurs. Since primer-dimers are shorter and they tend to run at a lower temperature, they are easy recognised in runing curve analysis. Light Upon Extension ( LUX primer ) : based on oligonucleotides labelled with a individual fluorophore. They do non necessitate a quencher mediety includes a single-labeled primer with a FAM fluorophore at the 3 terminal in a hairpin construction and a corresponding unlabelled primer, designed to amply the 5 terminal of the cistron encoding the S protein ofTGEV. The constellation of the labelled primer enables the fluorescence slaking capableness. When the primer is incorporated into double-stranded RT-PCR merchandise, the fluorophore is dequenched, ensuing in a important addition in fluorescent signal Unlike the current good known real-time engineering that relies on a man-made DNA investigation labeled with two different fluorescent dyes, LUX primers engineering does non necessitate an expensive investigation so is more suited for everyday research lab diagnosing. What a LUX check demands is a specific primer set with a individual labeled, self-quenched primer and a corresponding unlabelled one, it is more dependable than the real-time method usingDNA bindingdyes that may bring forth potentially deceptive consequences due to the deficiency of specificity of the dyes. A old survey besides indicates that the LUX primers engineering is dependable for quantitation of cistron look and the consequence is similar to the probe-based quantitative check ( Brian et al. , 2003 ) . LUX fluorogenic primers can be designed and ordered via online package. The LUX check besides has the advantage of addition velocity and is less arduous over the gel-based RT-PCR technique that is presently the everyday cistron analysis tool forTGEV. The LUX assay took less than an hr to finish the elaboration reaction and the procedure was viewed in existent clip, while conventional RT-PCR methods normally take more than 1h for cistron elaboration and half an hr or more to run the gel and analyze the consequence. The advantage of velocity of the LUX check is more evident when compared to other everyday diagnostic methods for TGE Furthermore, the LUX check is closed-tube and one-step technique, which reduces the hazard of taint and reaction variableness. This sensitive and specific trial complements bing cistron methods for the sensing ofTGEV. The method shall turn out to be a valuable tool in the research lab diagnosing ofTGEV, particularly as a agency of corroborating positive consequences from serological trials. LUX primers engineering supports manifold elaboration ( hypertext transfer protocol: //www.invitrogen.com/lux ) that makes observing different pathogens in a individual check possible. By utilizing two sets of primers, each labeled with a different dye, a individual LUX check can observe two different viruses. LUX primers are compatible with a broad assortment of real-time PCR instruments ( hypertext transfer protocol: //www.invitrogen.com/lux ) . More checks can be developed for the sensing of other pathogens. By cut downing the cost of real-time cistron sensing and with high public presentation, LUX fluorogenic primers engineering may has the possible to be used widely in the field ofanimal diseasesurveillance and control every bit good as import and export carnal quarantine direction. Advantages of utilizing DNA for microbic Testing Deoxyribonucleic acid is stable and unswayed by environmental factors while being independent from bacterial fundamental law doing consequences conclusive non subjective. It is accurate due to species specific mark sequence which is unattainable with cultural methods and public presentation controls can be added. There are good established DNA sensing methods available which enable fast sensing. Reliable industry of primers and investigations. 2.1 Preparation of Deoxyribonucleic acid from bacterial strains The undermentioned Enterobacteriaceae strains were obtained ( MicroBioLogics Inc, Minnesota, USA ) Escherichiacoli ( ATCC 11775 ) , Serratiamarcescens ( ATCC 13880 ) , Enterobacteraerogenes ( ATCC 13048 ) , Salmonella typhimurium ( ATCC 13311 ) Erwinia persicina ( ATCC 1381 ) Shigella flexneri ( ATCC 9199 ) Klebsiella pneumonia ( ATCC 700603 ) , Yersinia enterocolitica ( ATCC 9610 ) Listeria monocytogenes ( ATCC 19115 ) , Vibrio parahaemoliticus ( ATCC 17802 ) , Aeromonas hydrophila ( ATCC 7966 ) and Campylobacter jejuni ( ATCC 29428 ) . The University of Limerick supplied the strains Cronobacter sakazakii, Enterobacter cloacae, Pseudomonas aeruginosa and Proteus Mirabilis. The National Collection of Type Cultures ( Health Protection Agency Culture Collections, Salisbury, UK ) supplied Staphylococcus aureus ( NCTC 8325 ) . All strains of bacteriums were stored on Protect beads 109 ( LangenBach services Ltd, Dublin, Ireland ) at -20Â °C until cultivation. All Enterobacteriaceae strai ns grown on alimentary agar ( NA ) ( Oxoid, Basingstoke, UK ) at 37Â °C for 24hr AÂ ± 2 hour except Erwinia persicina which was grown at 30Â °C, Listeria monocytogenes and Staphylococcus aureus grown at 37Â °C. Vibrio parahaemoliticus grown at 35Â °C on Trypic soybean agar ( TSA ) ( Oxoid ) Confirmation and Identification of the mention micro-organism E coli. The designation of Escherichia coli ( ATCC 11755 ) was verified by the undermentioned biochemical trials. The Gram discoloration process was applied to a settlement from the fresh civilization on NA. Oxidase trial was carried out utilizing oxidase strips ( bioTRADING, Dublin, Ireland ) . A positive control of Pseudomonas aeruginosa and a negative control of Staphylococcus aureus were used to corroborate the dependability of the trial. API designation utilizing ID 32E was carried out harmonizing to maker s instructions ( BioMerieuxAÂ ®S.A, Craponne, France ) and identified utilizing the package Apiweb ( BioMerieux ) 2.2 Preparation of bacterial suspension. Pre-cultures were prepared by infixing a loop full of bacterial settlement into Nutrient Broth ( Oxoid ) with incubation of 37Â °C for all Enterobacteriaceae with the exclusion of Erwinia persicina which was grown at 30Â °C, Listeria monocytogenes and Staphylococcus aureus grown at 37Â °C. A loop full of Vibrio parahaemolyticus was grown at 35Â °C on Tryptic Soya Broth ( TSB ) ( Oxoid ) In peculiar the growing of Escherichia coli in alimentary stock was studied by mensurating the optical denseness and home base numeration. Spectrophotometric measurings were obtained at 600nm utilizing ( insert name here ) .Optical denseness was acquired every 30min from 0min to 4h 30min 2.3 Usual spiking of vouchers and recovery by swobing. Stainless steel vouchers of class 304 were obtained. Regions to be spiked with Escherichia coli were indicated utilizing a templet ( ) ( 10cm x 10cm ) . Each voucher was spiked by pipetting 100AÂ µl of Escherichia coli civilization onto the surface and utilizing a spreader ( ) . After allocated clip ( 0min 30min or 60min ) , vouchers were swabbed utilizing cotton swab. Each voucher was swabbed twice: horizontally and vertically. Each swab was cut and placed into the interior tubing of swab extraction tubing system ( SETS ) ( Roche Diagnostics, Mannheim, Germany ) .Each aggregation tubing was later centrifuged at 10000g for 10min ( Sigma1-15 ) . Then the inner tubings and the supernatants were discarded. Pellets were re-suspended in 250AÂ µl Ringer one-fourth strength solution ( Oxoid ) . Dilution series in one-fourth strength toller solution were prepared, plated out on alimentary agar and incubated 18-24h at 37Â °C. 2.4 Study of the release of Bacteria from different swabs and sponges. Comparative survey of the recovery of Escherichia coli cells was performed utilizing cotton, rayon and alginate swabs. ( Copan Italia S.p.A, Brescia, Italy ) . 100AÂ µl of 18h Escherichia coli civilization were deposited straight onto each swab. Swabs were cut and placed into SETS tubes. Tubes were centrifuged at 10000 g for 10 min. Pellets were re-suspended with 200AÂ µl of quarter-strength Ringer Solution ( Oxoid ) . Dilution series were made and 100 AÂ µl of diluted sample were plated onto alimentary agar home bases ( Oxoid ) that were incubated at 37Â °C for 24 H. Large sponges ( Medical Supply Co Ltd, Dublin, Ireland ) were tested to retrieve bacteriums from surfaces by swobing after allocated clip ( 0 min, 30 min, 60 min ) . Each sponge impregnated with 10ml Maximal Recovery Diluent ( MRD ) ( Oxoid ) was inserted into a stomacher bag ( ) supplemented with 100ml of MRD and stomached utilizing stomacher ( ) for 120 s at high power. Dilution series were made and 100AÂ µl of diluted sample was plated onto alimentary agar home bases ( Oxoid ) that were incubated at 37Â °C for 24 H 2.5 Detection and Quantification of feasible bacteriums from surfaces. Plate numeration expression was obtained as per ISO 4833:1991 ( Harrigan W.F 1998 ) which has since been renewed to ISO 4833:2003 Microbiology of nutrient and animate being eating materials Horizontal method for the numbering of micro-organisms Colony-count technique . The home base numeration expression was? c/ ( n1 + 0.1 n2 ) vitamin D where? degree Celsius was the amount of all settlements counted on all dishes, n1 was the figure of dishes in 1st dilution, n2 was figure of dishes in 2nd dilution and vitamin D represented the dilution. Miles and Misra method as per Harrigan W.F ( 1998 ) was used in peculiar when proving recovery of Escherichia coli from the big sponges. 2.10 Bacterial designation of bacteriums in the suspension used to make the unreal nutrient environment on surfaces. The suspension was prepared from 34 swabs samples that were collected from nutrient contact surfaces in Dawn Fresh Food Company, Fethard, Co. Tipperary. Each swab was assorted with 0.1 % peptone H2O ( Oxoid ) and the suspension were pooled together to make one chief suspension that was assorted with half volume glycerol 50 % ( Sigma Aldricha„? Inc ) . This suspension was aliquoted into 1ml eppendorf tubings and maintain in at -80Â °C. A entire feasible count was determined by utilizing the Miles and Misra method and later by home base numeration following a dilution series of bacterial suspension. The sensing of Listeria monocytogenes, Staphylococcus aureus and the Enterobacteriaceae were targeted. In the instance of Listeria monocytogenes 1ml of sample was dispensed into 9ml Buffer Peptone H2O ( Oxoid ) . Incubate 37Â °C for 18-24hours. After 24 H transportation 10ml from tubing into 90ml of Listeria Enrichment stock ( Oxoid ) , incubate for 48 H at 30Â °C guaranting agitation. After 48 h a loop full of solution was streaked on a Listeria agar home base ( Oxoid ) and incubated for 48 H at 30Â °C. Listeria Petrifilm ( 3Ma„? , Dublin, Ireland ) was used following maker s instructions. For the designation of Staphylococcus 100AÂ µl of unreal nutrient environment was plated on baird Parker agar ( Oxoid ) administering the organic burden throughout the home base utilizing a spreader and incubated at 37Â °C for 48 h. After 48 h agglomeration was tested utilizing PastorexAÂ ® Staph Plus trial. ( Biorad ) . Catalase activity was tested by the add-on of H2O2 ( ) . Each suspected Staphylococcus aureus settlement was placed in 1ml of toller solution that was later pipetted on to Staph Petri movie ( 3Ma„? ) . Petri movie was placed in brooder for 24 H at 37 Â °C. Enterobacteriaceae was detected utilizing most likely figure ( MPN ) See appendix. 2.6 DNA extraction: For specificity for PCR checks, bacterial pellets were obtained antecedently from civilizations in exponential growing stage were used with the exclusion of Camplyobacter jejuni. One settlement of C.jejuni was resuspended in 0.1 % Peptone H2O ( Oxoid ) and centrifuged at 5000 g for 5 min. For the quantification of bacteriums from surfaces, pellets were recovered from SETS after centrifugation of 1ml of civilization at 5000 g for 5 min. A rapid purification of DNA samples utilizing DNeasy Blood and Tissue Kit ( Qiagen, West Sussex, UK ) was preformed following maker s instructions. Deoxyribonucleic acid was extracted, purified and later quantified utilizing Nanodrop ND 1000 spectrophotometer ( ThermoScentific, Wilmington, USA ) Deoxyribonucleic acid concentrations were adjusted to 1ng per 2AÂ µl 2.7 Choice of Primer sets. 2.7-1 ENT Primers ENT primers developed by Nakano et Al ( 2003 ) and designed to temper to the 16S rRNA cistron of Escherichia coli. The sequence of the forward primer: 5GTTGTAAAGCACTTTCAGTGGTGAGGAAGG 3was 425 through 454 in the E. coli 16S rDNA while the sequence of the contrary primer 5GCCTCAAGGGCACAACCTCCAAG 3 had places 826 through 848 in the E.coli 16S rDNA. ENT primers expected to take to formation of 419-425 bp of PCR merchandise. 2.7-2 IEC primers: IEC primers as described by Khan et Al ( 2007 ) are oligonucleotide primer braces derived from the distal and proximal conserved flanking parts of the16S rRNA cistron, the Internal Transcribed Spacer ( ITS ) part and the 23S rRNA.IEC frontward primer 5CAATTTTCGTGTCCCCTTCG 3 and change by reversal primer 5GTTAATGATAGTGTGTGTCGAAAC 3 had expected PCR merchandise length of 450bp. 2.8 PCR Conditionss For a individual PCR 25 AÂ µl PCR reaction, PCR maestro mixes were prepared with unfertile DNA H2O, PCR buffer 2mM MgCl2, 25mM MgCl2, a dNTP mixture ( dATP, dTTP, dCTP, dGTP ) , frontward primer, change by reversal primer, DNA polymerase and 2AÂ µl of peculiar DNA. PCR was carried out on G-STORM GS2 Thermal Cycler. ( Familial Research Instrumental Ltd, Braintree, UK ) . The elaboration conditions were as follow: stopping point palpebra and heated to 111Â °C, 95Â °C for 6 min, bacterial rhythm start of 28ycles, denaturation measure of 95AÂ °C for 30 s, tempering temp between gradient of 56-62AÂ °C depending on primer type for 15 s, elongation for 30 s at 72Â °C. End rhythm with elongation for farther 7 min at 72Â °C. Cycle was repeated 30 times. 2 % Agarose gel ( Biosciences, Dun Laoghaire, Ireland ) pre-stained with SYBR Safea„? ( Molecular Probes, Eugene, USA ) cataphoresis was run in Tris ethanoate EDTA ( TAE ) . ( Sigma Aldricha„? Inc, Saint Louis, USA ) with Amplisize ( Biorad, Hercules, USA ) as a molecular marker runing from 50 to 2000 bp. The gel was examined in G-BOX ( Syngenes, Cambridge, UK ) under UV visible radiation. Recovery of E coli in the presence of an unreal nutrient environment Innoculum was prepared with pre-culture at the exponential stage when the concentration was 108cfu/ml. 100AÂ µl was pipetted onto chromium steel steel vouchers incorporating different concentrations of unreal nutrient environment ( high, medium or low concentrations ) . After allocated clip ( 0 min, 30 min, 60 min ) vouchers were swabbed at 90Â °angle. Swabs were cut into SETS ( Roche Applied Science ) and centrifuged for 10 min at 6000g. Pellet was re-suspended with 150AÂ µl toller solution leting 50AÂ µl for EMA intervention and 50AÂ µl for home base numeration. Preparation of Propidium monoazide ( PMA ) PMA dissolved in 20 % DMSO to obtain a stock concentration of 20nM and stored at -20Â °C off from the visible radiation. 1.25AÂ µl PMA solution added to 500AÂ µl of civilization aliquots to give a concluding concentration of 50nM following the incubation period of 5minutes in the dark with occasional commixture to let the PMA to perforate the dead cells and to adhere to the DNA. Samples are so put in ice and placed 20cm from 500W halogen visible radiation beginning for 15minutes. Samples centrifuged at 10,000g for 10 proceedingss. Samples washed with NaCl ( ) and MilliQ H2O ( ) in order to take the inactivated PMA. Bibliography. Angelotti R, Foter M.J, Busch K.A, Lewis K.H ( 1958 ) . A comparative rating of methods for finding the bacterial taint on surfaces Public Health Report 79 ( 11 ) pp 1021-1024 available: PubMed database [ accessed 10 March 2010 ] Astrographics ( 2002 ) Escherichia coli bacteria [ image online ] , available: hypertext transfer protocol: //www.astrographics.com/GalleryPrintsIndex/GP2144.html [ assessed 10 March ] Becker, B. , Weiss, C. , Holzapfel, W.H ( 2008 ) An rating of the usage of three phenotypic trial systems for biochemical designation of Enterobacteriacea and Pseudomonadacea Food Control 20 ( 9 ) available: Science Direct [ accessed 13 Feb 2010 ] Bej, A.K. , Steffan, R.J. , DiCesare, J. , Haff, L. , Atlas, R.M. , ( 1990 ) Detection of coliform bacteriums in H2O by polymerase concatenation reaction and cistron investigations. Applied Environment Microbiology 56 pp 307-314 Biomerieux Industry ( 2010 ) APIAÂ ®ID32E [ online ] available: hypertext transfer protocol: //www.biomerieux-industry.com/servlet/srt/bio/industry-microbiology/dynPage? open=NDY_IND_FDA_PRD A ; doc=NDY_FDA_PRD_G_PRD_NDY_17 A ; pubparams.sform=0 A ; lang=en [ accessed 19 March 2010 ] Bahrani- Mougeot F.K. , Paster, B.J. , Coleman, S. , Ashar, J. , Knost, S. , Sautter, R.L and Lockhart, P.B ( 2008 ) Designation of unwritten bacteriums in blood civilizations by conventional versus molecular methods Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology and Endodontology 105 ( 6 ) pp 720-724. Available: Science Direct [ accessed 11 March 2010 ] Copan Italia ( 2010 ) Why flocked swabs are superior to fibre cloaked swabs and froth swabs and how they can better infective disease nosologies , [ online ] , available: hypertext transfer protocol: //www.mls.be/nieuwsbrieven/css/Why-Flocked-Swabs-are-Superior-to-Fiber-and-Foam.pdf [ accessed 30 Feb 2010 ] Denton, M ( 2007 ) Enterobacteriaceae International Journal of Antimicrobial Agents 29 ( 3 ) available: Science Direct [ accessed 24 Feb 2010 ] Drudy D, O Rourke M, Murphy M, Mullane N.R, Kelly L, Fischer M, Sanjaq S, Wall P, OMahony M, Whyte P, Fanning S ( 2006 ) Characterisation of a aggregation of Enterbacter sakazakii isolates from environmental and nutrient beginnings International Journal of Food Microbiology 110 ( 2 ) pp 127-134 available: Science Direct database [ accessed 18 March 2010 ] Food Market Exchange ( 2001 ) HACCP Hazard Analysis Critical Control Point [ online ] available: hypertext transfer protocol: //www.foodmarketexchange.com/datacenter/laws/detail/dc_lr_reference_haccp [ accessed 17 Feb 2010 ] Galani I, Rekatsina P.D, Hatzaki D, Plachouras D, Souli M, Giamarellou H ( 2007 ) Evaluation of different research lab trials for the sensing of metalo-?-lactamase production in Enterobacteriaeae , Journal of Antimicrobial Chemotherapy 61 pp 548-553 Grant, M.A. , Weagent, S.D. , Feng, P ( 2001 ) Glutamate decarboxylase cistrons as a pre-screening marker for sensing of Escherichia coli groups Applied Environment Microbiology 67 pp 3110-3114 Griffith C.J, Davidson C.A, Peters, A.C and Fielding, L.M ( 1997 ) Towards a strategic cleansing assessment programme: hygiene monitoring and ATP luminometry, an options assessment Food Science Technology Today 11, pp 15-24. Hall L.B and Hartnett M.J ( 1964 ) Measurement of bacterial taint on surfaces in infirmaries Public Health Report 79 ( 11 ) pp 1021-1024, available: PubMed database [ accessed 24 March 2010 ] Horachova, K. , Mlejnkova, H. , Menjnek, P. , ( 2006 ) Direct sensing of bacterial fecal indexs in H2O samples utilizing PCR Water Science Technology 54 pp 135-140 Huang M.M, Arnheim N, Goodman M.F ( 1992 ) Extension of base mispairs byTaqDNApolymerase: deductions for individual nucleotide favoritism in PCR Nucleic Acids Research 20 ( 17 ) pp 4567-4573 Iqbal, S. , Robinson, J. , Deer, D. , Saunders, J.R. , Edwards, C. , Porter, J. , ( 1997 ) , Efficiency of the polymerase concatenation reaction elaboration of the uid cistron for sensing of Escherichia coli in contaminated H2O Lett Applied Microbiology 24 pp 498-502 Janda, J.M and Abbott, S.L ( 2001 ) Bacterial Designation for Publication: When is Enough, Enough? Journal of Clinical Microbiology 40 ( 6 ) pp 1887- 1891 Juck, D. , Ingram, J. , Prevost, M. , Coallier, J. , Greer, C ( 1996 ) Nested PCR protocol for the rapid sensing of Escherichia coli in drinkable H2O , Canadian Journal of Microbiology 42 862-866 Kang D, Eifert J.D, Williams R.C ( 2007 ) Evaluation of Quantitative Recovery Methods of Listeria monocytogenes Applied to Stainless Steel Journal of AOAC International 90 ( 3 ) Kenyon College ( 2010 ) , PCR sum-up of technique [ image online ] , available: hypertext transfer protocol: //biology.kenyon.edu/courses/biol114/Chap08/Chapter_08a.html [ accessed 20 March 2010 ] Kenyon College ( 2010 ) PCR sum-up of technique [ image online ] , available: hypertext transfer protocol: //biology.kenyon.edu/courses/biol114/Chap08/Chapter_08a.html [ accessed 20 March 2010 ] Khan, I.U.H. , Gannon, V. , Kent, R. , Koning, W. , Lapen, D.R. , Miller, J. , Neumann, N. , Phillips, R. , Robertson, W. , Topp, E. , Bochove, E. , Edge, T.A ( 2007 ) Development of rapid quantitative PCR check for direct sensing and quantification of culturable and non- culturable Escherichia coli from agiculture water partings Journal of Microbial Methods 67 pp 480-488 available: Science Direct [ assessed 13 March 2010 ] Kubista, M. , Andrade, J.M. , Bengtsson, M. , Forootan, A. , Jonak, J. , Lind, K. , Sindelka, R. , Sjoback, R. , Sjogreen, B. , Strombom, L. , Stahlerg, A. , Zoric, N. , ( 2006 ) The existent clip polymerase concatenation reaction Molecular Aspects of Medicine 27 pp95-125 available: Science Direct [ accessed 11 March 2010 ] .REVIEW Louie, M. , Louie, L and Simor, A. , E. ( 2000 ) . The function of DNA elaboration engineering in the diagnosing of infective diseases Canadian Medical Association Journal 163 ( 3 ) , pp 301-305 Mc Pherson, M. J. , Hames B. D, and Taylor, G. , R. , ( 1995 ) , PCR 2: A Practical Approach Oxford University Press, New York Microbiological hazard appraisal series 10 ( 2006 ) Enterobacter sakazakii and Salmonella in powdery baby expression, Google Books [ online ] , available: hypertext transfer protocol: //books.google.com/books? id=iHZSx2Wfe7EC A ; pg=PA76 A ; dq=enterobacteriaceae+in+food A ; as_brr=1 A ; cd=1 # v=onepage A ; q=enterobacteriaceae % 20in % 20food A ; f=false [ assessed 9 March 2010 ] Mossel D.A, Stryijk C.B ( 1995 ) Escherichia coli, other Enterobacteriaceae and extra indexs as markers of microbiologic quality of nutrient: advantages and disadvantages , Microbiologica 11 ( 1 ) pp 75-90. Available: Medline [ accessed 24 Feb 2010 ] Moore and Griffith ( 2002 ) Factors act uponing recovery of micro-organisms from surfaces by the usage of traditional hygiene swobing , Dairy, Food and Environmental Sanitation 22 ( 6 ) pp 410-421 Mueller, S.A. , Anderson, J.E and Byung, K ( 2009 ) Comparison of Plate counts, Petrifilm, Dipslides and Adenosine Triphosphate Bioluminescence for supervising bacteriums in chilling H2O armored combat vehicles , Water Environmental Research 81 ( 4 ) available: Wilson web [ accessed 24 March 2010 ] Nygren, J. , Svanvik, N. , Kubista, M. , ( 1998 ) The interaction between the fluorescent dye thiazole orange and DNA Biopolymers 46 pp 39-51 Ortega, M.P. , Hagiwara, T. , Watanabe, H. , Sakiyama, T. ( 2009 ) Adhesion behavior and removability of Escherichia coli on chromium steel steel surface Food Control 21 ( 4 ) pp 573-578 available: Science Direct [ accessed 13 March 2010 ] Reilly W.J. , Forbes, G.I. , Sharp, J.C.M. , Oboegbulem, S.I. , Collier, P.W and Paterson, G.M ( 1988 ) Poultry- Borne Salmonellosis in Scotland , Epidermiology and Infection 101 ( 1 ) pp 115-122 Rose, R.E. , Geldreich, E and Litsky, W ( 1974 ) Improved membrane filter method for fecal coliform analysis , Applied Microbiology 70 ( 9 ) pp 5692 5694. Roche PCR Applications Manual ( 2006 ) 3rd ed. , Germany: Fanz and Neumayer Rosrak D.B, Colwell R.R ( 1987 ) Survival schemes of bacteriums in the natural environment Microbial Rev 51 pp 365-379. Tsen, H.Y. , Lin, C.K. , Chi, W.R. , ( 1998 ) Development and usage of 16S rRNA cistron targeted PCR primers for the designation of Escherichia coli cells in H2O Journal of Applied Microbiology 85 pp 554- 560 Van Acker, J. , De Smet, I. , Muyldermans, G. , Bougatef, A. , Naessens, A. , Lauwer, S. ( 2000 ) Outbreak of Necrotizing Enterocolitis Associated with Enterobacter sakazakii in Powered Milk Formula , Journal of Clinical Microbiology 39 ( 1 ) pp 293-297 Wook Oh, S and Kang, D.H ( 2004 ) , Fluorogenic selective and differential medium for isolation of Enterobacter sakazakii , Applied and Environmental Microbiology, 70 ( 9 ) pp 5692-5694. Yang I, Kim Y H, Byun J.Y, Park S.R ( 2005 ) Use of manifold polymerase concatenation reactions to bespeak the truth of theannealing temperature of thermic cycling Analytic Biochemistry 338 ( 2 ) available: Science Direct [ assessed 10 March 2010 ]

Child Protective Services Essay Example | Topics and Well Written Essays - 1000 words

Child Protective Services - Essay Example Arguments from both sides will then help the audience reach a conclusion on their own. Running through a brief history of CPS, 1655 was the first time a criminal case was brought up against child abuse in the courts of what is now the United States of America. In 1825, states made laws etched in their law books to protect the rights of children and granting the authority to several agencies to remove children from the custody of parents and guardians who deemed unfit to perform the parental role (Thomas, 295). By 1974, 49 U.S States had passed the law, hence the federal government moved quickly to pass the federal â€Å"Child Abuse Prevention and Treatment Act† (CAPTA) (Pecora et al, 232). This act was actually the last calling to establish the CPS which started functioning with proper rules and policies by the end of 1974. Thesis CPS is an essential part of the current society in the modern world; it should be made a strong agency with the proper backing of law enforcement ag encies so it is a reckoning force against those who tackle with the future of our young generation. A lot of voices have been raised against the CPS and its services but every establishment has its flaws, so does the CPS. As the number of cases reported in a year on a rise each year, more efforts have to be made for securing the future of our country. Arguments are that the program should be downsized because of its inability to do its job efficiently. However, the actual requirement now lies with the government to properly fund the program so no child goes unattended because the workers are not being able to attend to every child abuse report being filed with them. Support A variety of important people in the social service circles have been calling out for reforms or betterment for the system in place. Some even dare to propose the calling off of the CPS as they believe that it is not meeting the desired goals, across the nation. Abuse and neglect in children is still prevalent; t he system has loopholes through which parents and foster care givers are benefitting, covering their deeds by the noble act of performing their responsibility, key word being ‘act’. Every coin has two faces; both are different, almost opposites. American sentiment toward residential placement for troubled youths is increasingly suspicious, pessimistic, and even hostile. Yet many families are too dysfunctional to warrant keeping their youth at home and alternatives are scarce. Foster families are simply unavailable for many of the estimated 840,000 children who will require out-of-home placement by 1995. The most empirically supported criticism of residential placement is its limited positive influence on post placement problems such as delinquency (Pecora et al., 1992). Children are living on the roads because their parents are too poor or too intoxicated to even know their own identity, let alone take care of their children. Also the issue of child abuse is one which w ill have calamitous effect on the future generations. The only hope for the distressed children is the CPS. They take the children under their umbrella and place them with willing and caring families; families, who have taken up the added responsibility on their shoulders to provide care and affection to the children who did not have the same environment to grow in. It is a dangerous world for un-protected children out there;

Laptops in Lectures Essay Example | Topics and Well Written Essays - 750 words

Laptops in Lectures - Essay Example According to Fields, laptops use during lectures is the biggest distraction to listening of a student during lectures. This is because, when using the machine, so many catchy items may come along as in the internet, there is usually breaking news on celebrities which is an area of interest to most of the students in class. Fields further believes most of the addictives come with the use of internet which causes very big distractions like playing new games (Fields 1). I would like to disagree with this idea, as the use of computers in lectures can be used to establish the rate and level of attentiveness of a student while in class. Most of the students that are allowed to use these machines at lectures have the highest rate of concentration level. This is attributed to the fact that most of these students have to pay attention to any idea that a lecturer puts across and record it as well. This means that laptops increase the level of concentration and also allows the students to multi task.   According to Fields, there is heavy reliance on the internet for any source of information currently. Most of the students allowed to use laptops during lectures tend to rely on the internet for any new information which does not allow the students to use their brains to think even the most basics ideas. Most students have become so reliant on this technological gadget and even the most reliable sources of information that is found in books are currently not being paid attention to.  

World Leaders And Their Leadership Styles History Essay

World Leaders And Their Leadership Styles History Essay Adolf Hitler is recognized worldwide for his leadership in the Nazi Party and also as the chancellor of Germany during the early period of 1930s. His leadership style was autocratic leadership as he believed in acting like a dictator and focused on making decisions on his own. He never trusted his generals and felt no need of having two-way communication as he wanted to have complete legitimate power in everything. Hitler believed that the ultimate authority resides with him and it should never be extended downward. He made decisions that were supportive in enhancing his legitimate power. Any mistake made by the followers was unacceptable and punishments were given for wrong doings (Megargee, 14). Since Hitler was reluctant to take advice from anyone and made all decisions on his own, his followers did not like this attitude and started developing ill-feelings towards him. From the analysis of Adolf Hitlers leadership style, the leaders of the todays world have realized that they cannot be a dictator and cannot get the work done by forcing their followers (Popper, 64). The modern leaders and managers in organizations have ensured that they implement collaborative methods so that the followers and subordinates are part of the team and the joint efforts will ultimately produce positive results. The leaders who have adopted this style of leadership have faced strong resistance from their followers and even received less support from them in accomplishing the ideal objectives. Mahatma Gandhi is among the favorite personality of most of the leaders worldwide and majority of them want to follow the leadership style followed by such an inspirational man (Barnabas and Paul, 135). Mahatma Gandhi had a servant style of leadership which is described as the style in which a leader takes care of his followers even before they start taking care of themselves on their own. This inspirational leader emphasized that the struggle should be done in non-violent manners without using any harmful weapons; the leader had to face severe problems such as beating by the British police and getting locked up in the prison when he started fighting with British for independence of India. Gandhi had a clear vision about the independence of Hindus and was able to communicate this vision effectively to dispersed people by using simple and inspiring language. One aspect that was stressed by the leader was never to accept defeat and keep on striving hard because success will eventually; the moral is that people should never lose hope and continue the efforts until the goal is attained (Nojeim, 30). His personality is a source of inspiration for the leaders and managers of todays world that no matter how challenging the situation gets it is important to boost the morale of oneself and the followers. As a leader, the person should motivate his/her subordinates until the victory is gained in the particular mission. Abraham Lincoln Abraham Lincoln had the desire of serving his country so that he could bring revolutionary changes that will be beneficial for its people in the long-run. Abraham Lincoln had a servant leadership style; one of the vital components of this form of leadership is the importance of ethical values i.e. working for the benefits of the people and this aspect was evident in the leadership style of Lincoln (Hubbard, 21). The servant leader wants to lead the people because he/she has internal desire of serving the people; the person does not need any legitimate power to bring the changes. Abraham Lincoln focused on the sustainability element which meant producing a lasting change that will finally lead to the transformation of others. The leader was provided the opportunity of demonstrating his leadership traits during the American Civil War; he had two lasting impacts on the world i.e. freeing the slaves and preservation of the Union (Polelle, 40). During his Presidency, Lincoln followed a prudent and careful leadership to bring about mandatory reforms in the United States of America. The leader also set the example of the paramount democracy in the world and even extended the liberty opportunity to every American. In present times, Americans have been given the full liberty of expressing their feelings and fighting for their rights and it has revolutionized the way in which democracy should be implemented by the leaders so that projected results are successfully accomplished. Even in organizations, the work culture has been changed i.e. employees are motivated to share their ideas and claim their rights as the organization is compelled to fulfill all the requirements of its workforce. Alexander the Great At the age of twenty, Alexander became the king and in eleven years of his journey he fought more that seventy battles and never lost any one of them. The leadership style of Alexander the Great is visionary leadership as he shared the vision with his people to motivate them to inspire them in achieving the well-set goals (Polelle, 23). From the analysis of the leadership traits of Alexander the Great, it is evident that he had set certain set of principles to inspire his followers such as show people that they are considered to be valuable and are given importance in every decision by seeking their opinions, lead by example so that people are inspired to follow the leader, innovation should be encouraged so that something new can be done and every action should be taken after creating a vision so that there is clarity about the goal that will be achieved (Cartledge, 14). In todays world, the leaders have realized that they need to first follow what they tell their followers so that the leaders can gain their trust. When any decision is made, it should be done on a consensus manner so that everyone agrees to it and they can see the big picture clearly. A visionary leader communicates to his followers the effectiveness of the entire process and their importance in this process so that their production level gets accelerated. Julius Ceasar Julius Ceasar was an exceptional general and one of the important leaders in ancient Rome. In his life, he held almost every vital title in the Roman Republic such as tribune of the Roman people, consul, well-known priest and high positioned commander of the army (Freeman, 32). He dared to introduce new laws that were easily approved by the Senate and he is recognized globally for improving the ways in which the provinces were governed and he even developed his own army. After conquering the Rome, he became the master and started ruling the place like a dictator. Caesar used his power for carrying out the needed reforms, relieving huge amount of debt, revised the calendar and enlarged the Senate. He was assassinated by his enemies in 44 B.C. (Popper, 70). It shows that a dictator has less chances of gaining appreciation by the followers as all other leaders who have followed the dictatorship style of leadership have never been able to get the support of their people and have faced unfortunate deaths in the form of assassination. Hence, the dictatorship leadership is not acceptable by people as the leaders tend to focus on their own benefits rather than on the followers needs. Napolean Napolean was among the best conquerors of the world and his efforts are recognized globally. During the French Revolution period, the leader took various important decisions that proved to be harmful for his followers (Blaufarb, 42). Although the positive aspects of his personality were that he had a clear vision about his goal, had the ability of motivating the people to achieve the desired goals and ensured that he took proper care of his people. However, his followers believed that the leader made decisions that were beneficial for himself and cared less for them. Napolean has received a lot of criticism for being a dictator as many wrong decisions were taken by him that severely impacted the lives of people. Since he was an ambitious person, he started making decisions without taking consent of his followers and started giving commands to his army (Polelle, 62). When he got carried away in the lust of power, he had to face defeat by the Russian Army on his way back to Austria; it shows that the dictators or autocratic style of leadership is among the least preferred styles of the leader. When a leader becomes a dictator, his/her relationship with the followers starts to get deteriorated and eventually it breaks. Napoleon is still considered to be the best conqueror in the world as he had the highly exceptional intellectual capabilities. Genghis Khan Genghis Khan was among the noteworthy leaders of Mongolia who conquered most of the Asian and European areas; his style of leadership is classified as a combination of autocratic leadership and participative leadership. Genghis Khan was considered a dictator because whenever he conquered any of the regions he would give only two options i.e. either surrender or get killed. However, when working with his army, he used to take their opinion and share his ideas with them so that they can develop a strategy for the implementation of the plan successfully (Ratchnevsky, 26). Genghis Khan moved to the loyalty to himself and he even started to deal with his adversaries in an inappropriate manner. Anyone who opposed to his conquest and power had to suffer from an extreme blow. Since Genghis Khan started treating people in a brutal way, he was assassinated later by his enemies (Man, 51). It has become important for todays leaders to realize that they can be successful only when they have cordial relations with their followers and they try to incorporate their demands so that a healthy relationship is created which will last for a long period. The autocratic leaders will face strong resistance from their followers so it is advisable to use it to minimal extent to ensure control within the organization or legal body but it should not be followed excessively as it will create problems such as retaliation from subordinates in the long-run. George Washington George Washington had a servant leadership style as he had the vision of revolutionizing everything in US during his presidency. He knew that he can motivate the people only by developing an inspirational personality and he did extensive efforts for creating the desired image. He even motivated his people to provide him support in attainment of the goals so that the set vision can be accomplished (Northouse, 72). The main characteristics of his personality as a leader were that he was willing to accept any challenge and face it; he was persistent in achieving the set targets; and was brave enough to handle all the issues and provided help to his people in resolving them. Since he had no lust for power and wanted to work for the benefits of his people, he always ensured that the decisions made by him were in accordance with the requirements of the country. As he was a trustworthy president, people started showing their loyalty to him and provided their complete assistance so that they could successfully implement any necessary change in the country effectively (Bongilla, 35). The leaders who want to gain the support of their followers have to develop their personality that has certain key traits such as confidence, integrity, courage, self-discipline and clear vision. George Washington is the best example for all those leaders who want to do something beneficial for the country and get the support of its people. Franklin D. Roosevelt Franklin D. Roosevelt is recognized for helping U.S. to get out of the Great Depression period in 1930s by helping the people in rebuilding their self-confidence. His leadership style is a combination of charismatic leadership and transformational leadership as he inspired the people to get back on their feet and initiate the activities to help the country get out of the dark times. Roosevelt provided his people various avenues to do a lot of creative thinking but with a focused approach; he first set out the vision so that everyone was aware of the final goal that has to be attained (Greenstein, 45). The best lesson learnt from the leadership of Franklin D. Roosevelt is that fear is something that needs to be conquered and there is nothing to fear about. The leaders can take inspiration from such an extraordinary leader who taught people how to maintain their focus on specific vision and face the challenges with courage and bravery. It is mandatory for every leader to accept the challenge of life and work and be prepared to handle them with confidence and will power to counter the challenge. Since the changes happen at a fast pace these days, the leaders have to remain alert all the time for the problems that can arise and they should react to them in a calm and an organized way. Winston Churchill Winston Churchill leadership style is classified as transformational and charismatic leadership; he was among those leaders who always kept the people motivated by delivering inspirational speeches. During the World War II, Winston Churchill provided immense support and guidance to the Great Britain by developing strength and courage among the people (Nordquist, 2). As a leader, he focused on three important aspects for developing a charismatic personality that comprised of elements such as excellent communication skills, creating a vision so that everyone is able to keep a focus on single goal and developing trust so that people are willing to provide their support to the leaders. From the leadership style of Winston Churchill, it is evident that the leaders have to develop a charismatic leadership by strengthening the bond with their followers so that everyone is part of the team (Axelord, 34). When the entire team shares a common vision, only then conflicts, problems and issues can be resolved. As most of the organizations have to undergo changes, they will face resistance from the people; communication is the key to resolving this issue by sharing with them the purpose of the change along with showing them the vision. Hence, excellent communication and well-designed vision can inspire people to work hard and support their leaders in achieving the desired goals. Conclusion The world leaders have demonstrated different leaderships and they have been successful in accomplishing various challenging tasks. Regardless of the dictatorship style, some of the common features that are important for the leaders and organization in todays world are creating a vision so that everyone has an idea about the goal that will be achieved in the long-run, motivating people to make valuable contributions and developing excellent communication skills so that a clear, concise and right message can be communicated to everyone. Therefore, the leaders and managers have to realize that they can achieve their objectives by getting support from their followers and subordinates and showing them appreciation for making valuable additions by offering them excellent rewards. The leaders have to develop a charismatic personality so that they can inspire their followers and should lead by example so that positive results can be attained.

Philosophies of Learning Theory

INTRODUCTION What is theory? A theory is a way of thinking and a model of how things work, how principles are related, and what causes things to work together. Learning theories address key questions, for example, how does learning happen? How does motivation occur? What influences students’ development? A theory is not just an idea. It’s an idea that is a coherent explanation of a set of relationships that has been tested with lots of research. If the idea survives rigorous testing, that theory is said to have empirical grounding. A theory is developed from practical experience as well as research.Any given theory is usually about one aspect of the learning process. Learning theories  are  conceptual frameworks  that describe how information is absorbed, processed, and retained during  learning. Learning brings together cognitive, emotional, and environmental influences and experiences for acquiring, enhancing, or making changes in one's knowledge, skills, valu es, and world views. There are three main categories of learning theory:  behaviorism,  cognitivism, and  constructivism. Behaviorism focuses only on the objectively observable aspects of learning.Cognitive theories look beyond behavior to explain brain-based learning. And constructivism views learning as a process in which the learner actively constructs or builds new ideas or concepts. Philosophies of teaching and learning, numerous philosophers have studied what the meaning of to teach and learn, and have come up with various explanations of the process of becoming educated. Their begin to refine their own beliefs and understandings of what it means to know through examining numerous theories of knowledge and making sense of the processes of teaching and learning in their own minds.An few philosophies and examples of individuals who exemplify the concepts are worth exploring: Existentialism (Maxine Greene, Jean-Paul Sartre, Soren Kierkegaard, Simone de Beauvoir), Critical T heory (Karl Marx, Henry Geroux, Michael Apple, Paulo Friere), Behaviorism (B. F. Skinner), Cognitivism / Developmentalism (Maria Montessori, A. S. Neill, John Dewey, Knowles, Waldorf Schools, Reggio Emilia Schools), Social Constructivism (John Dewey, Lev Vygotsky, Jerome Bruner, Montessori, Reggio Emilia and Waldorf Schools). 1. 0 LEARNING THEORIESIn  psychology  and education,  learning  theories are attempts to describe how people and animals learn, thereby helping us understand the inherently complex process of learning. There are three main categories (philosophical frameworks) under which learning  theories fall: behaviorism, cognitivism, and constructivism. 1. 1 Behaviorism Behaviorism focuses only on the objectively observable aspects of learning and discounts the internal processing that might be associated with the activity. Learning is the acquisition of new  behavior  through conditioning. There are two types of possible conditioning: ) Classical conditionin g, where the  behavior  becomes a reflex response to stimulus as in the case of Pavlov's Dogs. 2) Operant conditioning where there is reinforcement of the  behavior  by a reward or a punishment. The theory of operant conditioning was developed by B. F. Skinner and is known as Radical Behaviorism. The word ‘operant’ refers to the way in which behavior ‘operates on the environment’. Briefly, a behavior may result either in reinforcement, which increases the likelihood of the behavior recurring, or punishment, which decreases the likelihood of the behavior recurring.It is important to note that, a punisher is not considered to be punishment if it does not result in the reduction of the behavior, and so the terms punishment and reinforcement are determined as a result of the actions. Within this framework, behaviorists are particularly interested in measurable changes in behavior. 1. 2. Cognitivism Since the Cognitive Revolution of the 1960s and 1970s, learning theory has undergone a great deal of change. Much of the empirical framework of Behaviorism was retained even though a new paradigm was begun. Cognitive theories look beyond behavior to explain brain-based learning.Cognitivists consider how human memory works to promote learning. So for example how the natural physiological processes of encoding information into short term memory and long term memory become important to educators. Once memory theories like the Atkinson-Shiffrin memory model and Baddeley's Working memory model were established as a theoretical framework in Cognitive  Psychology, new cognitive frameworks of learning began to emerge during the 1970s, 80s, and 90s. Today researchers are concentrating on topics like Cognitive load and Information Processing Theory.These theories of learning are very useful as they guide the Instructional design. 1. 3. Constructivism Constructivism views learning as a process in which the learner actively constructs or builds n ew ideas or concepts based upon current and past knowledge. In other words, â€Å"learning involves constructing one's own knowledge from one's own experiences. † Constructivist learning, therefore, is a very personal endeavor, whereby internalized concepts, rules, and general principles may consequently be applied in a practical real-world context. 1. 4. Informal and Post-Modern TheoriesInformal theories of education deal with more practical breakdown of the learning process. One of these deals with whether learning should take place as a building of concepts toward an overall idea, or the understanding of the overall idea with the details filled in later. Modern thinkers favor the latter, though without any basis in real world research. Critics believe that trying to teach an overall idea without details (facts) is like trying to build a masonry structure without bricks. Other concerns are the origins of the drive for learning.To this end, many have split off from the mains tream holding that learning is a primarily self taught thing, and that the ideal learning situation is one that is self taught. According to this dogma, learning at its basic level is all self taught, and class rooms should be eliminated since they do not fit the perfect model of self learning. However, real world results indicate that isolated students fail. Social support seems crucial for sustained learning. Informal learning theory also concerns itself with book vs real-world experience learning. Many consider most schools severely lacking in the second.Newly emerging hybrid instructional models combining traditional classroom and computer enhanced instruction promise the best of both worlds. 2. 0 PHILOSOPHY ON LEARNING THEORIES. People have been trying to understand learning for over 2000 years. Learning theorists have carried out a debate on how people learn that began at least as far back as the Greek philosophers, Socrates (469 –399 B. C. ), Plato (427 – 347 B. C. ), and Aristotle(384 – 322 B. C). The debates that have occurred through the ages reoccur today in a variety of viewpoints about the purposes of education and about how to encourage learning.To a substantial extent, the most effective strategies for learning depend on what kind of learning is desired and toward what ends. Plato and one of his students, Aristotle, were early entrants into the debate about how people learn. They asked, â€Å"Is truth and knowledge to be found within us (rationalism) or is it to be found outside of ourselves by using our senses (empiricism)? † Plato, as a rationalist, developed the belief that knowledge and truth can be discovered by self-reflection. Aristotle, the empiricist, used his senses to look for truth and knowledge in the world outside of him.From his empirical base Aristotle developed a scientific method of gathering data to study the world around him. Socrates developed the dialectic method of discovering truth through conv ersations with fellow citizens (Monroe, 1925). Inquiry methods owe much of their genesis to the thinking of Aristotle and others who followed this line of thinking. Strategies that call for discourse and reflection as tools for developing thinking owe much to Socrates and Plato. The Romans differed from the Greeks in their concept of education.The meaning of life did not intrigue them as much as developing a citizenry that could contribute to society in a practical way, for building roads and aqueducts. The Romans emphasized education as the vocational training rather than as the training of the mind for the discovery of truth. Modern vocational education and apprenticeship methods are reminiscent of the Roman approach to education. As we will see, however, strategies to encourage cognitive apprenticeships combine the modeling inherent in learning by guided doing with the discourse, reflection, and inquiry that the Greeks suggested to train the mind.When the Roman Catholic Church be came a strong force in European daily life (500 A. D. to 1500 A. D. ), learning took place through the church, through monasteries, and through their school system, which included the universities (12th century) the Church built throughout Europe. Knowledge was transmitted from the priest to the people (Monroe, 1925). Much learning was the memorization and recitation of scripture by rote and the learning of trades by apprenticeship. The primary conception of the purpose of education was transmission-based.Many classrooms today continue a transmission-based conception of learning as the passing on of information from the teacher to the student, with little interest in transforming it or using it for novel purposes. The Renaissance (15th to the 17th centuries) revived the Greek concept of liberal education, which stressed education as an exploration of the arts and humanities. Renaissance philosophers fought for freedom of thought, and thus Humanism, a study of human values that are n ot religion-based, was born.By the sixteenth century the control of the Catholic Church was being challenged on a number of fronts, from Copernicus (1473 – 1543) who suggested that the sun rather than the earth was the center of the Solar System, to Martin Luther (1483 – 1546) who sought to secularize education (Monroe,1925). The notions of individual inquiry and discovery as bases for learning were reinforced in the Renaissance. In a sense the recurring ideological debates over education for â€Å"basic† skills – the reproduction of facts and rudimentary skills – vs. ducation for thinking – the effort to understand ideas and use knowledge for broader purposes – replay the medieval vs. Renaissance conceptions of the purposes of education. Rene Descartes (1596 – 1650) revived the Platonic concept of innate knowledge. Descartes believed that ideas existed within human beings prior to experience and that God was an example of an i nnate idea. He recognized that the body could be appreciated and studied as a zoological machine, while the mind was separate and free from the body.He was one of the first to define precisely the ability of the environment and the mind to influence and initiate behavior. He also described how the body could produce unintended behaviors. Descartes’ first description of reflex action was influential in psychology for over 300 years (Hergenhahn, 1976). While these findings supported the work of behavioral psychologists seeking to understand the genesis of behaviors, his focus on the mind also supported the work of later cognitive scientists who sought to understand the thinking process itself.John Locke (1632 – 1704) revived Aristotle’s empiricism with the concept that the child’s mind is a blank tablet (tabula rasa) that gets s haped and formed by his/her own experiences. He believed the mind becomes what it experiences from the outside world. â€Å"Let u s suppose the mind to be, as we say, white paper, void of all characters, without any ideas: How comes it to be furnished? †¦ Whence has it all the materials of reason and knowledge? †¦ from experience† (Locke, quoted in Hilgard and Bower 1975).The mind gathers data through the senses and creates simple ideas from experience; these simple ideas combine to develop complex ideas. Locke believed that education should structure experiences for students and that one essential learning was the kind of discipline that could be developed through the study of mathematics (Hergenhahn, 1976). The idea that different disciplines provide qualitatively different mental experiences and means of training the mind undergirds the basis of the discipline-based liberal arts education.Jean-Jacques Rousseau (1712 – 1778) was one of the first philosophers to suggest that education should be shaped to the child. He celebrated the concept of childhood and felt that children should be allowed to develop naturally. â€Å"The only habit which the child should be allowed to form is to contract no habit whatever. † (Rousseau, quoted in Hilgard and Bower, 1975) In Rousseau’s novel, Emile (Rousseau, 2000), the hero learns about life through his experiences in life. Complex ideas are built from simple ideas that are gathered from the world around him (Hilgard and Bower, 1975).The child-centered philosophies of Dewey, Montessori, Piaget and others follow in part from similar views. Kant (1724 – 1804) refined and modernized Plato’s rationalist theory with his suggestion that â€Å"a priori† knowledge was knowledge that was present before experience. For Kant, awareness of knowledge may begin with experience but knowledge existed prior to experience. Kant espoused that these ideas must be innate, and their purpose is to create an organizing structure for the data that is received by the senses.Kant was also one of the first to recognize t he cognitive processes of the mind, the idea that the mind was a part of the thinking process and capable of contributing to the thoughts that it developed. This learning theory opened the door to Piaget and others who would further develop the ideas of cognition (Monroe, 1925). Edward Thorndike (1874 – 1949) is considered by many to be the first modern education psychologist who sought to bring a scientific approach to the study of learning. Thorndike believed that learning was incremental and that people learned through a trial and error approach.His behaviorist theories of learning did not consider that learning took place as a result of mental constructs. Instead, he described how mental connections are formed through positive responses to particular stimuli. For Thorndike, learning was based on an association between sense impressions and an impulse to action. Thorndike favored students’ active learning and sought to structure the environment to ensure certain sti muli that would ‘produce’ learning. The father of modern behaviorism, B. F. Skinner (1904 – 1990), further developed Thorndike’s Stimulus-Response learning theory.Skinner was responsible for developing programmed learning which was based on his stimulus response research on rats and pigeons in experiments that provided positive reinforcement for â€Å"correct† responses. He considered learning to be the production of desired behaviors, and denied any influence of mental processes. Programmed learning gave proper reinforcement to the student, emphasized reward over punishment, moved the student by small steps through discrete skills and allowed the student to move at their own speed. â€Å"There are certain questions which have to be answered in turning to the study of any new organism.What behavior is to be set up? What reinforcers are at hand? What responses are available in embarking upon a program of progressive approximation that will lead to t he final form of the behavior? How can reinforcements be most effectively scheduled to maintain the behavior in strength? These questions are all relevant in considering the problem of the child in the lower grades. † Jean Piaget (1896 – 1980) was the first to state that learning is a developmental cognitive process, that students create knowledge rather than receive knowledge from the teacher.He recognized that students construct knowledge based on their experiences, and that how they do so is related to their biological, physical, and mental stage of development. Piaget spent years observing very young children and mapping out four stages of growth: sensorimotor (birth to about 2 years), preoperational (roughly ages 2 –7), concrete operations (encompassing about ages 7- 14) and formal operations (beginning around ages 11 – 15 and extending into adulthood.His work acknowledged the utility of some behaviorally-guided rote learningwhile also arguing that ot her activities that support students’ exploration are essential: The Russian scientist Vygotsky (1896 – 1934) extended Piaget’s developmental theory of cognitive abilities of the individual to include the notion of social-cultural cognition – that is, the idea that all learning occurs in a cultural context and involves social interactions. He emphasized the role that culture and language play in developing students’ thinking and the ways in which teachers and peers assist learners in developing new ideas and skills.Vygotsky proposed the concept of the zone of proximal development (ZPD) which suggested that students learn subjects best just beyond their range of existing experience with assistance from the teacher or another peer to bridge the distance from what they know or can do independently and what they can know or do with assistance (Schunk, 1996). John Dewey (1859 – 1952) agreed in part with Rousseau that education should not be separ ate from life itself, that education should be child-centered, guided by a welltrained teacher who is grounded in pedagogical and subject knowledge.Like Locke, he believed that structured experience matters and disciplinary modes of inquiry could allow the development of the mind, thus creating a dialectic between the child and the curriculum that the teacher must manage. The teacher’s goal is to understand both the demands of the discipline and the needs of the child and then to provide learning experiences to enable the student to uncover the curriculum. Dewey believed that the ability of a person to learn was dependent on many things, one of which was the environment. . 0 Future trends There are many changes occurring in the twenty-first century which will influence the nature of learning and learning styles being adopted. Perhaps the most significant change is that universities are now increasingly competing with a range of non-traditional education providers. This will f orce higher education into a pro-active stance in understanding how students learn best, and how teaching impacts on learning. Additional contemporary changes include globalisation, modularisation, mobility of earners, distance education/elearning/flexible learning, lifelong learning, mass education, and work-based learning. ‘The de-institutionalisation of education, in the form of open and independent learning systems, is creating a need for learners to develop appropriate skills’ (Knowles, 1975, p. 14). The impact here on learners is the gradual move away from the more traditional forms of teaching and learning, where information was transmitted to the student through physical interaction between teacher and student, to more self-directed, student-centred approaches.Problem-based learning is an example of one approach to learning where the learner needs to take responsibility for his or her own learning, with the teacher now increasingly assuming the role of facilitat or of student learning. The impact of technology and the internet will continue to increase, having economic and social implications for society. For instance people can now work from home if they have immediate access to a computer. This may facilitate the increase of distance-learning courses as students no longer have to attend a physical campus to gain qualifications.Increasing modularisation enables many students to learn at their own pace, in their own time. CONCLUSION The Philosophy of education has been shaped over centuries with certain philosophers and their thoughts directly affecting it. A good example is Plato and his  educational philosophy  that was christened Republic. He argues that the society would be holistic if children at a tender age would be raised with a system of education that natures their intellectual capabilities with facts, physical discipline, music, art and skills.The same principles can be applied to an individual institution. This can be define d as a collective approach informed by educational philosophy  to aid in teaching in a way that the objective of imparting knowledge is achieved within a reasonable time. This philosophy of education is subject to review and modification, total over haul or improvements depending on whether the constant evaluation shows whether the goals set have been achieved or not. The drastic advances in technology have also affected the educational philosophy.The world is moving towards the web 2. 0, where technological interaction between learners and teachers is emphasized. Another factor that informs education philosophy is the fact that the world is changing its educational strategies. At one point in history, education was a transit of knowledge from the tutor to student. With nationals encouraging innovations and research in various fields, students are encouraged to discover, be inquisitive and get to learn through active experiments and research.This is a way that has revolutionized t he way education policy makers and other stakeholders define philosophy of education. The relevancy of a given  philosophy of education  therefore, is determined by the educational needs of a given society. REFERENCES 1- Level3, Issue 2, June 2004, Dublin Institute of Technology, Learning Theories and Higher Education; Frank Ashworth, Gabriel Brennan, Kathy Egan, Ron Hamilton, Olalla Saenz; 2- Critique of Various Philosophies and Theories of Education; Ted Slater, Philosophy of Education / Dr.William Cox / Regent University. 3- 2007, Pearson Education, Inc. H. Douglas Brown. -5th Edition; Principles of Language Learning and Teaching. 4- Kurzweil, R. (1996) The Age of intelligent machines â€Å"Chronology†. Retrieved September 18, 2012 from http://www. kurzweiltech. com/mchron. htm. 5- 2001, Stanford University, Developed by Linda-Darling Hammond, Kim Austin, Suzanne Orcutt, and Jim Rosso; How People Learn: Introduction To Learning Theories.

Informative Outline About Coco Chanel

Informative Presentation Outline Fundamentals of Oral Communication Topic: Coco Chanel General Purpose: To Inform Specific Purpose: By the end of my speech the audience will know better about Coco Chanel. Thesis: Coco Chanel brought the world of high fashion to the masses. Introduction I. Does anyone know what this logo is? A. I am assuming most of women in this room know what this is. B. This is Chanel logo, one of the most famous fashion brand in the world. C. A lot of women know Chanel and they are fascinated of Chanel products, but how many people know about Coco Chanel, the first designer of Chanel?II. Today, I am going to inform my audience about who Coco Chanel was, and her famous fashion product lines. III. Thesis statement: Coco Chanel brought the world of high fashion to the masses. Transition: Now, let’s begin with who Coco Chanel was. Body I. Who is Coco Chanel? A. She is a successful woman who overcame being an orphan. 1. Coco was born out of wedlock in the French town of Saumur in the Loire Valley on 19 August 1883 ( De La Haye, 2005). a. Coco was sent to an orphanage with her two sisters when her mom died of asthma at her age twelve, and her father left his children. b.In 1900, at her age seventeenth, she left the orphanage and attended the local convent school in Moulins (South of France) (De La Haye, 2005). c. Having been taught to sew by her aunts, her sister and she found work as dressmakers, assisting Monsieur Henri Desboutin of the House of Grampayre( De La Haye, 2005) 2. By 1903, Chanel moved to Paris and had become the mistress of a well-to-do young military officer, Etinenne Balsan (J. Baughman (Ed. ), 2001). a. She started designing hats for her friends. b. Around 1910 Balsan and her lover Capel helped Chanel set up a millinery shop at 21 rue Cambon in Paris (J.Baughman (Ed. ), 2001). c. Her Simple, elegant hats charmed the society women to whom Balsan and Capel introduced her, and by 1915 she was able to open additional shops in the resort towns of Deauville and Biarritz, France (J. Baughman (Ed. ), 2001). d. In that year she also moved into couture, designing dresses, skirts, and sweaters in jersey, a fabric not previously used in the French fashion houses (J. Baughman (Ed. ), 2001). B. She was the first woman to start a cosmetics line and the first to have a perfume named after her (Brownell, 2009). C. Coco Chanel’s real name is Gabrielle Chanel. . After she left the orphanage, she sang during evening concerts at a fashionable cafe called La Rotonde. 2. According to a quotation from a book â€Å"A Woman of Her Own† by Axel Madsen, â€Å"The only cabaret songs she knew besides â€Å"Qui qu’a vu Coco? † was â€Å"Ko ko ri ko† (Madsen, 26). 3. She earned her nickname ‘Coco’ from the songs that she sang at the cafe. Transition: Now that I’ve talked about who Coco Chanel was, now I will discuss her famous fashion product lines. II. What are her famous fa shion product lines? A. Chanel No. 5 is one of the most prestigious scents in the world (J.Baughman (Ed. ), 2001) 1. According to â€Å"The Secret of Chanel No. 5†, Chanel No. 5 is sold in nearly every country 2. One bottle is sold every 30 seconds (The Secret of Chanel No. 5). 3. More than 100 million dollars is made each year of this perfume (The Secret of Chanel No. 5). B. Coco Chanel’s â€Å"The Little Black dress† is thought to be element to the world of women’s fashion. 1. Almost a century after its real birthday in 1925, the Little Black Dress (LBD) is still the standard cocktail-party uniform for women the world over (Brownell, 2009). 2.According to Encyclopedia of clothing and fashion, American Vogue described the little black dress as â€Å"The Chanel ‘Ford’-the frock that all the world will wear† (De La Haye, 2005). Conclusion I. Today I discussed who Coco Chanel was, and her famous product lines. II. Coco Chanel brought the world of high fashion to the masses. III. Remember even though Coco Chanel was orphan she overcame and became one of successful women in the world, so do not give up on following your dream like Coco Chanel! References Brownell, G. (2009). Coco Puffs. Newsweek,  154(5), 58-59 Chanel, gabrielle ‘coco'.In (2001). J. Baughman (Ed. ),American Decades  (Vol. 3). Gale. Retrieved from http://go. galegroup. com. resources. kirkwood. edu/ps/retrieve. do? sgHitCountType=None&sort=RELEVANCE&inPS=true&prodId=GVRL&userGroupName=kirkwood_main&tabID=T003&searchId=R1&resultListType=RESULT_LIST&contentSegment=&searchType=BasicSearchForm ¤tPosition=3&contentSet=GALE|CX3468300801&&docId=GALE|CX3468300801&docType=GALE De La Haye, A. (2005). Chanel, gabrielle (coco). In S. Valerie (Ed. ),  Encyclopedia of Clothing and Fashion  (Vol. 1, pp. 49-254). Charles Scribner's Sons. Retrieved from http://go. galegroup. com. resources. kirkwood. edu/ps/retrieve. do? sgHitCountType=None;sort=RELEVA NCE;inPS=true;prodId=GVRL;userGroupName=kirkwood_main;tabID=T003;searchId=R1;resultListType=RESULT_LIST;contentSegment=;searchType=BasicSearchForm ¤tPosition=1;contentSet=GALE|CX3427500122;;docId=GALE|CX3427500122;docType=GALE Madsen, A. (1990). Chanel: A woman of her own. New York: H. Holt. The Secret of Chanel No. 5. (n. d. ). Hudson City School District. Retrieved from http://www. udson. edu/custom_users/mmtech/18011/18011/Chanel_No. 5. html Coco Chanel: My Hero. Retrieved March 6, 2013, from http://www. lovetwenty. com/2012/01/coco-chanel-my-hero/ Chanel Video Podcast. Retrieved March 6, 2013, from http://www. channels. com/episodes/show/13038194/CHANEL-Paris-Shanghai-12#/ajax/feeds/show/598/CHANEL-FASHION Famous French People, Coco Chanel. Retrieved March 6, 2013, from http://www. euroclubschools. org/page45. htm Chanel No. 5. Retrieved March 6, 2013, from http://www. chanel. com/en_US/fragrance-beauty/Fragrance-N%C2%B05-N%C2%B05-8818